ID: 1187900908

View in Genome Browser
Species Human (GRCh38)
Location X:24025754-24025776
Sequence GCCGGGACGCGGGGCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187900908_1187900924 23 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC No data
Right 1187900924 X:24025800-24025822 TTCCCACCGAGGAAAACAGGCGG No data
1187900908_1187900927 27 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC No data
Right 1187900927 X:24025804-24025826 CACCGAGGAAAACAGGCGGCCGG No data
1187900908_1187900923 20 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC No data
Right 1187900923 X:24025797-24025819 GGTTTCCCACCGAGGAAAACAGG No data
1187900908_1187900928 28 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC No data
Right 1187900928 X:24025805-24025827 ACCGAGGAAAACAGGCGGCCGGG No data
1187900908_1187900916 -1 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC No data
Right 1187900916 X:24025776-24025798 CTGCCGGCCCGCCACGCCAGCGG No data
1187900908_1187900921 12 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC No data
Right 1187900921 X:24025789-24025811 ACGCCAGCGGTTTCCCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187900908 Original CRISPR GCCGGGACGCGGGGCGCCGC GGG (reversed) Intronic