ID: 1187900908

View in Genome Browser
Species Human (GRCh38)
Location X:24025754-24025776
Sequence GCCGGGACGCGGGGCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 381}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187900908_1187900916 -1 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1187900916 X:24025776-24025798 CTGCCGGCCCGCCACGCCAGCGG 0: 1
1: 0
2: 0
3: 20
4: 108
1187900908_1187900923 20 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1187900923 X:24025797-24025819 GGTTTCCCACCGAGGAAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 72
1187900908_1187900928 28 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1187900928 X:24025805-24025827 ACCGAGGAAAACAGGCGGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1187900908_1187900924 23 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1187900924 X:24025800-24025822 TTCCCACCGAGGAAAACAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 161
1187900908_1187900927 27 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1187900927 X:24025804-24025826 CACCGAGGAAAACAGGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 106
1187900908_1187900921 12 Left 1187900908 X:24025754-24025776 CCCGCGGCGCCCCGCGTCCCGGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1187900921 X:24025789-24025811 ACGCCAGCGGTTTCCCACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187900908 Original CRISPR GCCGGGACGCGGGGCGCCGC GGG (reversed) Intronic
900096003 1:940362-940384 GCGGGGGCGCTGGGCCCCGCTGG + Intronic
900349208 1:2227111-2227133 GCCCGAACGCCGGGCCCCGCGGG + Intergenic
900607869 1:3531802-3531824 GCCGGGCCGCGGGGCGGGGGAGG + Intronic
900633875 1:3652460-3652482 GCGGGGAGGGGAGGCGCCGCGGG - Intronic
901280037 1:8026600-8026622 GCCGAGGCCCGGGTCGCCGCGGG - Intergenic
902366158 1:15975789-15975811 GGCGGGGCGGGGGGCGTCGCCGG - Intronic
903250973 1:22052936-22052958 GCCGGGGCGGGGGTCGCGGCCGG + Intronic
903438319 1:23368946-23368968 GCCCCGGCGCGGGGCGGCGCGGG - Intronic
903883713 1:26529624-26529646 GCCGGCCCTCGGGGCGCGGCGGG + Intergenic
904068454 1:27773487-27773509 GCCGGGACGCAGGGCCCGGCTGG + Intronic
905179170 1:36156066-36156088 GCTGGGTCCCGGGGCGCTGCTGG + Intronic
905202422 1:36323458-36323480 GCCGGGAAGCGGGGCGCTGACGG - Intronic
905548556 1:38818338-38818360 GCGGCCACGCGGGGCGCCGTCGG + Intergenic
906208805 1:44000920-44000942 GCCGGGTCGCGGGAGGCCGGAGG + Intronic
906320713 1:44813693-44813715 GCGGCGACACGGGGCGCCCCGGG - Exonic
907051191 1:51330668-51330690 GCGGGAGCGCGGGTCGCCGCGGG - Intronic
908023812 1:59926827-59926849 GCTGGGAGGCGGGGCACGGCTGG - Intergenic
908473772 1:64469999-64470021 CCCGGGACGCCGGGGGCCGGGGG - Intergenic
910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG + Intergenic
911219719 1:95234120-95234142 GCGGAGGCGCGGGGCGCCCCCGG + Intronic
911618366 1:100038646-100038668 GCGGCGACGAGGGGCGCGGCGGG - Intronic
912305251 1:108560293-108560315 GCGCGGCCGGGGGGCGCCGCAGG - Exonic
912381303 1:109249617-109249639 GCGGGGACGCGGGGCGCGAGCGG + Intergenic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
914919624 1:151838519-151838541 GCCTGGCCGCGGGGAGCCGAAGG + Exonic
916783020 1:168056469-168056491 GCCGGGAGGCGGGGCGGGGAGGG + Intronic
919926414 1:202194054-202194076 GCCGGGCTGGGGGGCGCCGCCGG - Exonic
920333388 1:205228156-205228178 GCCGGGCTGCGGGGCGAGGCGGG - Exonic
920528399 1:206685059-206685081 GGCGGGTCGCGGGGCTCCGTGGG - Exonic
921604029 1:217135763-217135785 GTCGGGCCGCTGGGCGCCTCCGG + Intronic
922196589 1:223364525-223364547 GTCGGGGCGCGAGGCGCCGGCGG + Intergenic
922315054 1:224434615-224434637 GTCGCGCCGGGGGGCGCCGCGGG + Intronic
922488882 1:225999458-225999480 GCCGGGCGGCGGGGCGGTGCGGG + Intergenic
922695376 1:227728579-227728601 GGCGGGAGGCGGGGCGGGGCCGG - Intronic
922739393 1:228006926-228006948 GCCGAGGCCCGGGGCGGCGCGGG - Intergenic
923007884 1:230066977-230066999 GCCGGGGCGCGGGCCGCGGGAGG - Intronic
923490254 1:234478315-234478337 GCCCGGACGCCCGGCGCTGCTGG - Exonic
923684000 1:236142032-236142054 CCCGAGGCGCGGGGCGCGGCTGG + Intergenic
924042617 1:239998073-239998095 GCCGGTCCCCGGGGCGTCGCGGG + Intergenic
924415312 1:243850761-243850783 GAGGGGGCGCGGGGCACCGCTGG - Intronic
924436360 1:244047837-244047859 ACCTGGGCGCGGGACGCCGCAGG + Intergenic
1062774939 10:136230-136252 GCTGGGACGAGGGGGGGCGCCGG + Intronic
1063393681 10:5666598-5666620 GCCGGGCCGCGCGGGGCCGCTGG + Intergenic
1064086331 10:12349140-12349162 GGCCGGATGCGGGGCGCCGAGGG - Intergenic
1064208999 10:13347871-13347893 GCCGGGGAGCCGCGCGCCGCCGG - Intronic
1064712377 10:18140579-18140601 GCCGAGTCCCGGGGCGCTGCGGG + Intergenic
1065342841 10:24723235-24723257 GCCGGGACGCGCTAGGCCGCAGG + Intronic
1065588529 10:27242174-27242196 GCAGGAACGCCGGACGCCGCTGG - Intergenic
1070333024 10:75431468-75431490 GTCGGGGCGCGGGGCGCTGCGGG + Intronic
1070954212 10:80454086-80454108 GCCGGGAGGCGGGGTGCGGTGGG + Intergenic
1072249042 10:93567330-93567352 GCTGGGAAGCGGGGCCCCGACGG + Intronic
1073124342 10:101140347-101140369 GCTGGGACCCGCGGCGCGGCGGG + Intergenic
1073207302 10:101775940-101775962 GCCGTCCCGCGGGCCGCCGCGGG + Exonic
1074377397 10:112951322-112951344 GCCGGGGCGCGCGGGGCGGCCGG - Intronic
1074539197 10:114350870-114350892 GCCTGGACCCTGGTCGCCGCTGG - Intronic
1074591853 10:114821673-114821695 GCGGGGCCGCTAGGCGCCGCGGG - Intergenic
1075697555 10:124447906-124447928 CCTGGGACGCGGGGAGCCGGGGG + Exonic
1075801778 10:125159202-125159224 GCAGGGACCCGGTGCGGCGCAGG - Intronic
1076721863 10:132396593-132396615 GAGGGGACGCGGGGCGCCCGGGG - Intergenic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1078190933 11:9091857-9091879 GCGGGGATGCGGGGGGCAGCGGG - Intronic
1079076719 11:17389128-17389150 GCCGGGACCCGGCGCGGAGCGGG - Intronic
1080283896 11:30586432-30586454 GCAGGGGCGCGGGGTCCCGCCGG - Intronic
1080503671 11:32892857-32892879 GCCGGGACTCGCGGCGACGGCGG - Intergenic
1083232682 11:61333112-61333134 GCCGGGGCGCGGGGCATCACGGG + Exonic
1083609676 11:63998924-63998946 GGCGGGCCGTGGGGCGGCGCGGG + Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084175718 11:67421223-67421245 GGCGGGGCGCGGGGCGGGGCTGG + Intronic
1084295806 11:68213051-68213073 GCAGGGACGTGGGGGACCGCGGG - Intronic
1084575670 11:69986427-69986449 GCTGGGGCTGGGGGCGCCGCCGG + Intergenic
1084605027 11:70167486-70167508 GGAGGGACGCTGGGCACCGCAGG - Intronic
1085574423 11:77589761-77589783 GCGGGGAGGCGGGGAGGCGCGGG - Exonic
1089150189 11:116358244-116358266 GCCGAGACACGCGGCGCTGCAGG + Intergenic
1089466652 11:118690175-118690197 GCCAGGACGCTGGGCCCGGCGGG + Intergenic
1089622234 11:119728728-119728750 TCCGGGCCCCGGGCCGCCGCCGG + Exonic
1090327779 11:125904188-125904210 GGCGGGCCGCGGGGCGGCGCGGG + Intronic
1090736910 11:129618239-129618261 GGCGGGGCGCGGGGCGCAGCTGG - Intergenic
1091434136 12:460279-460301 GCCGGGACGCGGGGCGCCCTGGG + Intergenic
1091616106 12:2052643-2052665 GCCGGGGCGCGCGGCGCACCCGG - Intronic
1091718318 12:2795272-2795294 GTCGGAACCCGGGGCCCCGCGGG + Intronic
1092241859 12:6840516-6840538 GCCGGGACCAGGGGGGCCACTGG + Intronic
1094108008 12:26833408-26833430 GACGCGACGCTGGGCGGCGCTGG + Intergenic
1095440826 12:42237848-42237870 GCCGGAGCGCGGCGCGCCGAGGG - Intronic
1095687308 12:45050740-45050762 GCCGGGTCGTGGGGCGCGGGCGG + Exonic
1095949354 12:47773445-47773467 CCCGGGACGCTGGGCGGCGCGGG + Intronic
1095958306 12:47819067-47819089 CGCGGGAAGCGGGGCGCCGCAGG - Intronic
1096548313 12:52356334-52356356 GGCGGGACGCGGGGCGTCTCGGG + Intergenic
1096647590 12:53047185-53047207 GCGCGGGCGCGGGGCGCGGCGGG + Intronic
1097051176 12:56224266-56224288 GGCGGGACGCAGGGCGCGCCCGG + Intronic
1100611496 12:96194799-96194821 GGTGGGGCGGGGGGCGCCGCGGG + Intronic
1102884140 12:116508789-116508811 GCCTGGACCCGGGGAGCCCCGGG - Intergenic
1102913767 12:116737926-116737948 GCCGGGGCGCGGAACGCGGCAGG + Exonic
1103764469 12:123271104-123271126 GCCCGGGCGGGGGGCGCTGCGGG - Intronic
1103954243 12:124567572-124567594 GCCGGGGAGCGCGGAGCCGCGGG - Intronic
1104001540 12:124863668-124863690 GCCGGGGCGCTGGGCGTCGCGGG - Exonic
1104602278 12:130162090-130162112 GCCGGGAAAGGGGGCGCCGGCGG + Intergenic
1107468031 13:40666657-40666679 GCCGGCGCGCGCGCCGCCGCGGG - Intergenic
1107603916 13:42040486-42040508 GCCGGGAGGAGGGGCGGCGGGGG + Intronic
1108518235 13:51222436-51222458 GCCGGGAGGGAGGGCGCCCCGGG + Exonic
1110860631 13:80341506-80341528 GCCGTCACGCGGGGCGCCCGCGG + Intergenic
1112012159 13:95301474-95301496 GCGGGGACGGGGCGTGCCGCCGG - Intergenic
1112693020 13:101917052-101917074 GCCGGCGCCCGGGGAGCCGCCGG - Intronic
1113231674 13:108218719-108218741 GGAGGGTCGCGGGGAGCCGCCGG + Intronic
1113473147 13:110561247-110561269 GCCGGGACCCTGTGCGCGGCCGG + Intronic
1113981575 13:114281391-114281413 CCCCGGAAGCGGGGCGCCGGCGG - Intergenic
1115754265 14:36517610-36517632 GCCGCGACGCGTGGCGGTGCCGG - Exonic
1116835793 14:49768195-49768217 CCCGGGACTCGGGGCACTGCAGG - Exonic
1117131925 14:52695579-52695601 GCCCGGAGGTGGGGCGCCGCTGG - Exonic
1117353570 14:54902896-54902918 GCCGTGACGCGAGGCGGGGCCGG - Intergenic
1117690463 14:58299562-58299584 GCGGGGGCGCGGTGGGCCGCTGG + Intronic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1119046327 14:71321143-71321165 CCCGGGACGCGCGGCGGCACCGG + Intronic
1119106833 14:71932648-71932670 GCCGGGACTCGGGGCGCACAGGG - Exonic
1119261345 14:73239884-73239906 GCGGGGACGCGCGGGCCCGCAGG + Intronic
1119539249 14:75428058-75428080 GCCGCGACGGGGGGCGCTGGCGG + Intronic
1121014259 14:90538852-90538874 GCCGGGCCCCGGGTCACCGCTGG - Exonic
1121408466 14:93733485-93733507 GCCGGGACACGGGCCTCGGCAGG - Intronic
1122418228 14:101560521-101560543 ACCCGGGCGCGGGGCGCCACGGG - Intergenic
1122549960 14:102544484-102544506 GCCGGGATGGGGAGCCCCGCGGG - Intergenic
1122581985 14:102777128-102777150 GCGGGGACGCGCGGCGGCGGGGG + Intergenic
1123024896 14:105419934-105419956 GCGGGGGCGGGGGGCGCCGCAGG - Exonic
1123051582 14:105546718-105546740 GCCGGGCTGCGGGGCGCAGCGGG + Intergenic
1123076994 14:105672421-105672443 GCCGGGCTGCGGGGCGCAGCGGG + Intergenic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1124999381 15:34754776-34754798 GCCGGGACGAGGGGCGGGGCGGG + Exonic
1125514401 15:40309614-40309636 GCCGGGACCAGGGCAGCCGCAGG - Intergenic
1125603516 15:40927950-40927972 GCCGGGACGCGGCGCGAACCCGG - Intergenic
1127342899 15:58065860-58065882 GCCGGGACGCTTGGCGCCCACGG + Exonic
1127753621 15:62068641-62068663 CCCGGGACGAGGGCCGCGGCCGG + Exonic
1128161034 15:65422951-65422973 CCGGGGAGGCGCGGCGCCGCGGG + Exonic
1128269207 15:66293805-66293827 GCCGGGAGGCGGAGCGCCAGCGG + Intronic
1129424566 15:75454503-75454525 GCGGGTAGGCGGGGCGCCGGCGG - Intronic
1130613369 15:85380949-85380971 GACGGGTCGCCGGGCGGCGCCGG + Intronic
1131826025 15:96322964-96322986 GCCGCGACGCGGGGAGGCCCCGG + Intergenic
1132348326 15:101121789-101121811 GCCGGGCCGTGGGGCGTCTCGGG - Intergenic
1132419387 15:101652387-101652409 GCCGGGGGGCGGGGCGCGCCTGG + Intronic
1132480596 16:164747-164769 GCGGGGTCGCGGGGCGGGGCGGG + Intronic
1132480617 16:164788-164810 GCGGGGTCGCGGGGCGGGGCGGG + Intronic
1132480668 16:164878-164900 GGCGGGGCGCGGGGCGGGGCGGG + Intronic
1132480698 16:164936-164958 GGCGGGGCGCGGGGCGGGGCGGG + Intronic
1132483878 16:180451-180473 GCGGGGTCGCAGGGCGCGGCGGG + Exonic
1132498736 16:275633-275655 GCGGGGACGCGGGGCGGGCCGGG + Intronic
1132683752 16:1153842-1153864 GCCGGGACGCGAGGCGGAGCGGG + Exonic
1132797010 16:1729575-1729597 GGAGGTACGCGGGGCGCGGCGGG + Exonic
1132797019 16:1729600-1729622 GGAGGTACGCGGGGCGCGGCGGG + Intronic
1132837050 16:1959431-1959453 GCCGGGACCCGCCTCGCCGCAGG - Intergenic
1132844172 16:1992384-1992406 GCCTGGACGGGGAGCGCCGCGGG + Intronic
1132888039 16:2191027-2191049 GCCAGGATGCGGGGGGCCCCAGG - Intronic
1133021115 16:2967373-2967395 GCCCCGTCGAGGGGCGCCGCGGG - Exonic
1133073791 16:3264293-3264315 GCCCGGACGCGGGGAGGCGCTGG + Intronic
1133241296 16:4416090-4416112 GCCGGGGCTCGGGGCGCTGCCGG - Intronic
1134070270 16:11256084-11256106 GGCGGGGCGCGGGACGCCGCGGG + Exonic
1134121339 16:11586844-11586866 GCCGGGGCGCGGGGACCAGCGGG - Intronic
1136487932 16:30585309-30585331 GGCTGGAAGCGGGGCGCCGAGGG - Intronic
1137426328 16:48384702-48384724 CCCGGGCCTCCGGGCGCCGCGGG + Intronic
1139418023 16:66830515-66830537 GCCGGGATGCGGTGCGCCCCGGG + Intronic
1140221715 16:73048478-73048500 GCCGGTTCCCGGGGCGGCGCAGG - Intronic
1140223181 16:73058430-73058452 GCCCGGACGCGGGGCTCCTCGGG - Intronic
1140927620 16:79599292-79599314 GCCGGCGCGCCCGGCGCCGCGGG - Exonic
1141086062 16:81096325-81096347 GCCGGGAGGCGGGGCGGGGAGGG + Exonic
1141418923 16:83899201-83899223 GCCGGGGCCCGGGCGGCCGCGGG - Exonic
1141828561 16:86497338-86497360 GCCGGGACTCGGGGCTCGGCAGG - Intergenic
1141841939 16:86579161-86579183 GCCGGGCCCCGGGGCCCCGGAGG + Exonic
1141972241 16:87492246-87492268 CCCGGGTCGCGGCGCGGCGCGGG - Intergenic
1142156179 16:88533801-88533823 GCCGGGCCGGGGGGCGCCTTGGG - Exonic
1142393330 16:89816559-89816581 GCCAGGACCCAGGGGGCCGCCGG - Exonic
1142395266 16:89828361-89828383 GGAGGGACGCGGGGCGGGGCGGG - Intronic
1142763912 17:2055629-2055651 AACGGGCCGCGGGGCCCCGCGGG + Intronic
1142858917 17:2749434-2749456 GCCCGGACCCAGGGCCCCGCCGG - Intergenic
1142860024 17:2755720-2755742 GGCGGGCCGCCGGGCGCCGGGGG + Intergenic
1143188300 17:5023709-5023731 GCCGGGGCGGGGGGCTGCGCAGG + Exonic
1144565166 17:16353557-16353579 GCCGCGCTGCGGGGCGCGGCTGG - Intronic
1144758642 17:17694816-17694838 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1144971265 17:19111198-19111220 GCCGGGAGGGGGCGCGCCGGAGG - Intergenic
1147325637 17:39668180-39668202 GGCGGGACTCGGGGCGGGGCAGG + Exonic
1147392886 17:40121511-40121533 GCGGGGCCGCGGGGCCCCTCCGG + Intergenic
1147720397 17:42536318-42536340 GCCGGGGCCGGGGGCGCGGCAGG + Exonic
1147757890 17:42780540-42780562 GGCGGGCCGCGGGGCGGCGACGG + Intergenic
1148183038 17:45620499-45620521 GCTGGGAGGCGGGGGGCCGCGGG + Intergenic
1148265815 17:46225192-46225214 GCTGGGAGGCGGGGGGCCGCGGG - Intronic
1148576957 17:48719066-48719088 GCCGGCGCGCGGGGAGGCGCAGG - Intergenic
1148863708 17:50617933-50617955 GCCGGGAGGTGGGGGGCCTCTGG + Intronic
1149491012 17:57085318-57085340 GCCGGGCCGCGGGGCACAGCCGG + Intronic
1149996716 17:61409634-61409656 GCCGCGAGGCCGGGCGGCGCCGG + Intergenic
1150488521 17:65560088-65560110 GCCCGGGCTCGGGGCGCTGCTGG - Intronic
1150791772 17:68205323-68205345 GCCTGGACTCGGGGCGCGGATGG - Intergenic
1151812555 17:76453038-76453060 GCCGGGACGGGGGCTGCGGCTGG + Exonic
1152175146 17:78782317-78782339 CGCGGGGCGCGGGGCGCCGGGGG - Intergenic
1152551950 17:81034609-81034631 GCTCGGACGCAGGACGCCGCGGG - Intergenic
1152552606 17:81037265-81037287 GGCAGGACGCGGTGGGCCGCAGG + Intronic
1152697668 17:81804829-81804851 GCCGGGTGGTGGGGCGCCGGGGG - Intronic
1152748473 17:82051852-82051874 TCCGGGGCGCGGGGCGGGGCGGG - Intronic
1152923986 17:83079413-83079435 GCCGGGGCGGGGGGCGCTGCAGG - Intergenic
1152924174 17:83079924-83079946 GCCGGGCTGCTGGGCGGCGCGGG + Exonic
1152924255 17:83080166-83080188 GCCGGGAACCGGGACGCCGCGGG - Intronic
1153238920 18:3013365-3013387 GCGGGGGCGCGGCGCGCGGCCGG - Intergenic
1153514426 18:5891157-5891179 GCGGGGACGCGGCGCCCCGAGGG + Exonic
1153911512 18:9709232-9709254 GCGAGGACGCAGGGAGCCGCTGG + Intronic
1156036348 18:32771045-32771067 GCCGGGAAGTGGGGAGCCGGGGG + Exonic
1156088760 18:33440591-33440613 GCCTCGGCGCGGGGCGCTGCCGG - Intronic
1157867160 18:51197115-51197137 GCCGGGGCGCCGGGCTCCGCCGG + Exonic
1160503044 18:79411568-79411590 AGCGGGACGGGGGGCGGCGCGGG + Intronic
1160525286 18:79532210-79532232 GCCGGGGGGCGGGGGGCTGCAGG - Intergenic
1160525315 18:79532290-79532312 GCCGGGGGGCGGGGGGCTGCAGG - Intergenic
1160525331 18:79532330-79532352 GCCGGGGGGCGGGGGGCTGCAGG - Intergenic
1160567756 18:79797896-79797918 GGCGGTGCGCGGGGCGGCGCCGG + Intergenic
1160668413 19:344470-344492 GGAGGGACGCGGGGCGGGGCTGG - Intronic
1160831928 19:1108290-1108312 GCGGGGGCGGGGGGCGCGGCGGG - Exonic
1160838398 19:1135566-1135588 GACTGGGCGCGGGGCGCCGGAGG - Intronic
1160860366 19:1234982-1235004 GCCGGTAAGCGGGGCGGCGTTGG - Exonic
1160897016 19:1407847-1407869 GCCGGGCGGCGGGGAGCGGCGGG - Intronic
1160904585 19:1446245-1446267 GCCGAGGGGCGGGGCGCGGCGGG + Intergenic
1161264991 19:3359884-3359906 GCTGGCGCGCGGGGCGCCGCGGG + Intronic
1161320191 19:3637540-3637562 GCCGTGACGCTGAGCGCCTCGGG - Intronic
1161425009 19:4198467-4198489 TCCGGGGCGCGGGGCGCGGGGGG - Intronic
1161471259 19:4457709-4457731 GCCCGGCGGCGGGGGGCCGCGGG + Exonic
1162007549 19:7789682-7789704 GCCGGGCGGTGGGGCGGCGCCGG + Intergenic
1162046775 19:8005406-8005428 GCCTGGCCGCGGGGCGCCCGCGG - Intronic
1162471189 19:10872512-10872534 GCGGGGACGGTGGGAGCCGCAGG + Intronic
1162535831 19:11262456-11262478 GCCGGGGCCCGGGGCGGCGGCGG - Intronic
1162589116 19:11579033-11579055 GCCGGGAGGCGTGGCGGCTCTGG - Intronic
1162809064 19:13153512-13153534 GGCGGGGCGCGGGGCACAGCAGG - Exonic
1163442481 19:17328815-17328837 GGCGGGGCGCAGGGCGCCGGAGG + Exonic
1164208293 19:23075558-23075580 GCAGGGACGCGGCGAGACGCTGG - Intronic
1165274202 19:34734092-34734114 GCGCGGACCTGGGGCGCCGCGGG - Intergenic
1165420062 19:35718082-35718104 GGCCGGCCGCGGGGCGCCGGCGG + Exonic
1166367393 19:42284441-42284463 GCCGGGGGGCGGGGCGGGGCCGG + Intronic
1166679471 19:44758142-44758164 GCCGGCACGTGGGGCGGCACCGG - Intronic
1167134533 19:47608999-47609021 GCCTGGGCGCGGGGCGGCGGCGG + Intronic
1167449198 19:49557042-49557064 GTTGGGGGGCGGGGCGCCGCGGG - Intronic
1167455653 19:49595783-49595805 GCCAGGAGGAGGGGGGCCGCTGG - Exonic
1167638551 19:50668289-50668311 GCCGGGCCGCTGGGCGAGGCGGG + Exonic
1168154018 19:54463361-54463383 GCCTGGCCGCGAGGCGCAGCCGG - Exonic
925170011 2:1744522-1744544 GCTGGGACGTGGGCCGCGGCCGG - Intronic
926268294 2:11345022-11345044 GCCGCGGCGGGGGGCGCGGCCGG - Intronic
927652208 2:24919788-24919810 GCCGGGCCCCGAGGCGCTGCCGG - Exonic
927713769 2:25340800-25340822 GCCGGGACCGGGAGCGGCGCAGG - Intronic
927971375 2:27307865-27307887 GGCGGGACGCGCAGCGCTGCTGG - Exonic
930011397 2:46940972-46940994 GGCGGGAAGCGAGGCGCCCCCGG + Intronic
931321345 2:61177314-61177336 GCGGGGACGCGGGGACGCGCGGG - Intergenic
931665937 2:64609536-64609558 GAGGGGACGGGGGGCGCCGAGGG - Intergenic
932767863 2:74482599-74482621 GCCTGGAGGCGGGGGCCCGCAGG - Exonic
932780084 2:74554230-74554252 GCCGGGCGGCGGGGCGGCCCCGG + Exonic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
933667070 2:84971883-84971905 GCCGGGCCGCGGGCGGCAGCAGG + Intronic
935622858 2:105144190-105144212 GCCGGGCCGCGGGGGGTCGGCGG + Intergenic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
936389004 2:112055191-112055213 GCCGGGTAGGGAGGCGCCGCCGG - Intergenic
937912332 2:127081681-127081703 GCAGGGACGAGGGGTGCCGCTGG - Intronic
938795829 2:134718189-134718211 GCCGGGACTCGGGCGGCCTCTGG - Intronic
940774936 2:157875866-157875888 GGCGCGGCGCGGGGCGGCGCGGG + Intergenic
943060585 2:183038296-183038318 GCCGGGGCGCGGGCTGCTGCGGG - Exonic
946250131 2:218406535-218406557 TCCCGGACGCGGGGCGGGGCGGG - Intergenic
947119727 2:226801197-226801219 GCTGGGACCCGGCGGGCCGCGGG + Intergenic
947808407 2:232983886-232983908 GCCCGGACTCGGGGCCCAGCTGG - Intronic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948368942 2:237475341-237475363 GCCGGGCCGCGGGGGGCGGACGG + Intergenic
948393297 2:237627494-237627516 GCGGGGACGCGGGGGGACGGGGG - Intergenic
948823181 2:240560575-240560597 GGCGGGCCGCCGGGCGCCCCCGG - Exonic
949004582 2:241637844-241637866 GCCGGGGCGGCGGGCGCTGCGGG + Intronic
949040130 2:241844174-241844196 GCCGGGCCTCGGGGCTCCCCGGG - Intergenic
1169065632 20:2692977-2692999 GCCGGGACGCCGGGGCACGCGGG + Exonic
1171122433 20:22578509-22578531 GCCGGCCCGCCGGCCGCCGCAGG - Intergenic
1172596615 20:36154804-36154826 GCCGCGGGGCGGGGCGGCGCGGG - Exonic
1172702927 20:36863673-36863695 GCCGGGGCCCGGGCCGCAGCCGG - Exonic
1172919960 20:38473021-38473043 GCCGGGGCGGGCGCCGCCGCCGG - Exonic
1173454145 20:43189927-43189949 GGCGGGACGCGGGGGGCGGGGGG + Exonic
1175215330 20:57389421-57389443 GCCGGGAGCCCGGGCGCCTCCGG + Intergenic
1175447444 20:59032653-59032675 GCGAGGACGCGAGGCGGCGCGGG + Intergenic
1176114968 20:63428238-63428260 GCTGGGACGCGCGGGGACGCTGG - Intronic
1176173786 20:63708235-63708257 GCCGGGCGGGGGGGCGCGGCCGG + Intronic
1176173874 20:63708515-63708537 CCCGAGACGCGGGGCTCAGCTGG + Intronic
1179810005 21:43864750-43864772 GCCGGGGCGCGGGGTGGGGCCGG - Intergenic
1179967967 21:44817852-44817874 GGCGGGACGCGGGGCGGAGTCGG + Intronic
1180181520 21:46120527-46120549 GCCAGGCCGCGGGGCCCCTCAGG - Exonic
1180991823 22:19941700-19941722 GGCGCGGCGCGGGGCGCAGCAGG - Exonic
1181695902 22:24592740-24592762 GCCGGGAGGCGAGGCGGAGCTGG - Intronic
1182137465 22:27919261-27919283 GCAGGGAGGCGGGGCCGCGCAGG - Intronic
1182321409 22:29480365-29480387 GGCGGGACGCGCTCCGCCGCTGG + Exonic
1182664000 22:31944421-31944443 GCCGGGCGGCGGGGAGCGGCGGG - Intronic
1183528115 22:38336250-38336272 GCCGGGAAGCGGCGCGGGGCTGG - Intronic
1183720188 22:39557901-39557923 CCCGGGGCGCGGGGGGCGGCGGG - Intergenic
1184265466 22:43343635-43343657 GGCGGGGGCCGGGGCGCCGCGGG - Intergenic
1184276565 22:43412201-43412223 GGCCGGGCGCGGGGCGCGGCCGG + Intronic
1184465830 22:44668617-44668639 CCAGGGACTCGGGGCGCTGCAGG - Intronic
1184741736 22:46432438-46432460 TCCGGGAAGCGGGGCACAGCGGG + Intronic
1185278771 22:49961071-49961093 GCGGGGACCGGGGGCGCCCCGGG + Intronic
1185398456 22:50604238-50604260 GCAGGAAGGCGGGGCGGCGCGGG - Exonic
950729805 3:14947697-14947719 GACGGGCCCGGGGGCGCCGCCGG - Intronic
950940303 3:16884760-16884782 GCCGAGAGCCGGGGCTCCGCCGG + Intronic
950940355 3:16885021-16885043 GGCGGGTCGCGGGGCGCCCATGG + Intronic
951543624 3:23806103-23806125 GCCGGGGGGCGGCGGGCCGCTGG - Intronic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
953657033 3:44862153-44862175 GCGGGCGGGCGGGGCGCCGCTGG + Intronic
954437393 3:50503382-50503404 GCCGGGCCGAGAGGCGCCGCAGG + Exonic
954838896 3:53494524-53494546 GCCGGGGCGCGGCGCGGCGCGGG + Intergenic
960479532 3:118171496-118171518 GCCGGGGCCGGTGGCGCCGCCGG - Intergenic
961377430 3:126476051-126476073 GCTGGGCTGCGGGGCGCCGGAGG + Intergenic
961734735 3:128994164-128994186 GCCTGGGGGCGGGGCTCCGCGGG + Intronic
961754871 3:129121703-129121725 GCCCGGACCCGGTGCCCCGCGGG + Exonic
962240318 3:133746366-133746388 AAAGGGACGCGGGGCGCCGGAGG + Exonic
965757518 3:172040562-172040584 GCGGGGGAGCGGGGCGCGGCGGG + Exonic
966712030 3:182980723-182980745 GCGGGGGCGGGGGGCGCGGCGGG + Intronic
966787752 3:183636126-183636148 GCCGCGGGGCCGGGCGCCGCCGG + Intronic
966808747 3:183825601-183825623 GCGGGGACGCTGGGCGCAGGAGG - Intergenic
968513070 4:1003738-1003760 GCAGGGACGCAGGGCGGCGAGGG - Intronic
968603675 4:1521495-1521517 GCCGGGCCACGGGGCCCCGGCGG - Intergenic
968756359 4:2418243-2418265 GCCGCGACGCGGGGGGCGTCCGG + Intronic
970394856 4:15655424-15655446 GCGGGGACGCGGGGGCGCGCAGG + Intronic
977694321 4:99949864-99949886 TCCGGCCCGCGGCGCGCCGCAGG + Intronic
979122872 4:116926077-116926099 GCCCGGACGCGGGGCCGCCCTGG - Intergenic
979674652 4:123398279-123398301 GCCCGGCCGCGCGGAGCCGCGGG + Intronic
981782372 4:148443704-148443726 GCCGGGCTGCGGGTCGCCGAGGG - Intronic
984888646 4:184473248-184473270 CCCGGGGCGCGGGCCGCGGCGGG - Intronic
985896264 5:2751488-2751510 GCCGGGGCGCGGCGCGGCGGCGG + Exonic
986330609 5:6713906-6713928 GCCGGGCCTCGGGGCGCGGCGGG + Intergenic
986608433 5:9545508-9545530 GCCGCGCCGCGCCGCGCCGCTGG - Intronic
988577926 5:32444551-32444573 CCCGGGCAGCGGGGAGCCGCGGG - Intronic
989229884 5:39074091-39074113 GAGGTAACGCGGGGCGCCGCGGG - Exonic
991216870 5:64165909-64165931 GCCGGGACGGGGCGCGAAGCCGG + Exonic
991298191 5:65103096-65103118 GCCCGGAGGCGGGGCGCGGCGGG - Intergenic
992527929 5:77630033-77630055 GCCGGGAGACGGGGGACCGCGGG + Exonic
994497846 5:100535750-100535772 GCGGGGCCGCGGGGCTCCGAGGG + Exonic
996329412 5:122312263-122312285 GCCGGCGCGCCGGGCGCCCCGGG + Exonic
997635185 5:135399317-135399339 GCCGGGGCGCCGGGCGGCACGGG - Exonic
998156073 5:139787978-139788000 GGCTGAACTCGGGGCGCCGCTGG + Intergenic
1001496207 5:172188883-172188905 GCCGGGAAGCCGGGCCCTGCAGG - Intergenic
1002091854 5:176810705-176810727 GGCCGGGCGCGGGGCCCCGCGGG - Exonic
1002170314 5:177371039-177371061 TCCGGGCCGCGGGGCGGGGCGGG + Intronic
1002277428 5:178113341-178113363 GCAGCGACGCGAGGCGCAGCCGG + Intergenic
1002638333 5:180618991-180619013 GGCGGCCTGCGGGGCGCCGCGGG - Intronic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1002662789 5:180802899-180802921 GCCGGGGGGCGGGGCGCGGCGGG - Intronic
1002817275 6:692860-692882 GGGGGGTCGCGGGGCCCCGCAGG + Intronic
1002927712 6:1614536-1614558 GCCGGGCCCCGCGCCGCCGCGGG - Intergenic
1005928522 6:30464257-30464279 GCCTGGACCCGAGGCGCGGCTGG - Intergenic
1006502107 6:34465811-34465833 CCCGGCACGCGCGGGGCCGCGGG + Intergenic
1009964859 6:70567172-70567194 CCCGAGACCCGGGGCGCTGCAGG - Intronic
1010415036 6:75602445-75602467 GCCGGGATGAGGGGCCGCGCCGG - Exonic
1012170936 6:96016054-96016076 GCGGGGGCGCGGGGAGCTGCAGG - Exonic
1012887182 6:104859540-104859562 GCCGGGTCGCGGGGCCAGGCTGG - Intronic
1013369330 6:109455832-109455854 GCTGGGATGCGGGGCGGCCCGGG + Exonic
1014802313 6:125790857-125790879 ATCCGGACGCGGGGCCCCGCGGG + Exonic
1015149095 6:130019291-130019313 GCCGAGGCGGGGGGCGCCGGCGG + Intronic
1015181570 6:130366429-130366451 GTCGGGACGTCGGGCGCCTCTGG - Intronic
1015904992 6:138107551-138107573 GCCGGGGCGGGCGGGGCCGCTGG + Intergenic
1016923300 6:149317307-149317329 GGGAGGACGCGGGCCGCCGCTGG - Intronic
1018023960 6:159789641-159789663 GCCCGGCCGCGGGGCACGGCGGG + Exonic
1019099214 6:169614104-169614126 GCCGGGACTCGAGGCCCCGTGGG - Intronic
1019695335 7:2442789-2442811 GACGGGAGGCGGGGCTCCGGCGG - Intergenic
1019828440 7:3301962-3301984 GCCGGGAAGCGGGGGGACCCCGG - Intronic
1020023480 7:4883176-4883198 GCGGGGGAGCGGGGCGCAGCGGG - Intronic
1020080332 7:5283095-5283117 CGCGGGACGCGGGGAGACGCCGG + Intronic
1020727295 7:11831897-11831919 TCCGGGAGCCGGGGCGCTGCGGG - Exonic
1021958905 7:25852947-25852969 GCTGGGGCGCGGGGCGCTCCGGG - Intergenic
1023638783 7:42237889-42237911 GCTGGGAGGCGGCGCGTCGCGGG + Intergenic
1025004432 7:55343562-55343584 GCCGGTGGGCGGGGCACCGCGGG - Intergenic
1025198584 7:56949084-56949106 CGCGGGACGCGGGGAGACGCCGG - Intergenic
1025673368 7:63627852-63627874 CGCGGGACGCGGGGAGACGCCGG + Intergenic
1025778963 7:64582612-64582634 GCGGGGAGGCGGGGCGGGGCGGG - Intergenic
1026017505 7:66682559-66682581 GCCGGACCGAGGGGAGCCGCCGG - Intronic
1026025550 7:66741114-66741136 GCCGGGGCGAGGGGAGCCGCCGG - Intronic
1026825376 7:73578368-73578390 GCCGGGAGCCGGGACACCGCGGG + Intronic
1027145028 7:75688371-75688393 GCCCGGACCCGGCGCGCCCCCGG - Intronic
1029539110 7:101172673-101172695 GCGGGGAGGGGGGGCGCAGCAGG + Intronic
1029570168 7:101363526-101363548 GCTGGGGCGCGGGGCGGCGGGGG + Intronic
1032237930 7:130140908-130140930 GATGGGACGCGCGGCGGCGCCGG - Intergenic
1034911675 7:155002993-155003015 GTGGGGGCGCCGGGCGCCGCGGG - Exonic
1035004410 7:155644611-155644633 GCCGGGAGGCGGGCGGGCGCCGG - Intronic
1035101540 7:156401784-156401806 GGCGGGACACGGGGAGCTGCTGG - Intergenic
1035553403 8:545746-545768 GCTGGGGCCTGGGGCGCCGCGGG + Exonic
1035580782 8:738071-738093 GCCGGGACCCTGGGCTCCGGGGG + Intronic
1035717076 8:1763408-1763430 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717085 8:1763425-1763447 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717094 8:1763442-1763464 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717103 8:1763459-1763481 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717112 8:1763476-1763498 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717121 8:1763493-1763515 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717130 8:1763510-1763532 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717139 8:1763527-1763549 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717148 8:1763544-1763566 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717157 8:1763561-1763583 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717166 8:1763578-1763600 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1036739409 8:11347557-11347579 GAGGGGCCGCGTGGCGCCGCGGG - Intergenic
1037811440 8:22089318-22089340 GCCGGGCCGCCGGGAGTCGCGGG + Intronic
1037811493 8:22089453-22089475 GAGGGGAAGCGGGGCGCGGCCGG - Intronic
1038540431 8:28386113-28386135 GCCGGGCCGCGGGCCGCGCCGGG - Intronic
1040981746 8:53251684-53251706 GCCGGGACGCGGCTGGGCGCTGG + Exonic
1041166920 8:55101168-55101190 GCGGCGGCGCGGGGCGCGGCCGG - Intergenic
1043854173 8:85245716-85245738 GCGGGACCGCGGGGCGCCGGCGG - Exonic
1044818063 8:96133238-96133260 GACGGGGCGCGGGGCGGGGCGGG - Intergenic
1045516316 8:102863683-102863705 GGCCGGCCGCGGGGCGCTGCGGG + Intronic
1048009276 8:130443341-130443363 GCCGGGACGGGGCGCGGGGCGGG - Intronic
1049109699 8:140635380-140635402 GCCGGGGATCGGGGGGCCGCGGG - Intronic
1049625421 8:143617599-143617621 CCCGGGACGCTGCGCGCCCCCGG - Intronic
1049643956 8:143727832-143727854 GTTGGGGCGCGGGGCTCCGCTGG + Exonic
1049673167 8:143878541-143878563 GCCCCGACGCGGGGCGGGGCGGG + Intergenic
1049756602 8:144313733-144313755 GCGGGGAGGCGGGGAGGCGCGGG - Intronic
1049784736 8:144444797-144444819 GCGGGGACGCGGGAGGCCGGGGG + Intergenic
1049879574 8:145052647-145052669 GCCGGGAAGCCGGGCTCCGCGGG - Exonic
1051170606 9:14315458-14315480 CCCGGGGCCCGGGGCGCCGGCGG + Intronic
1056170672 9:83981093-83981115 GCCGGGCCCGGGGGCGCAGCTGG + Intronic
1056732477 9:89178102-89178124 GCCGGGGCGCGGGGCGCCGAGGG + Exonic
1057076621 9:92141502-92141524 GCCGGGCTGGGGGGCGCAGCCGG - Intergenic
1057488603 9:95506021-95506043 GCCGGGCCGCGGAGCGGGGCCGG + Intronic
1059208454 9:112487389-112487411 GCCGGGCGGCGGGGCGGCCCGGG - Intronic
1060283340 9:122228288-122228310 GCCGGTACCCGGCGCGCCGAGGG - Intronic
1060485839 9:124045670-124045692 GCCTGCTCGCGGGGAGCCGCGGG - Intergenic
1060514632 9:124258112-124258134 TCCGGGCCGCGGGGCCCCACCGG - Intronic
1061190793 9:129081451-129081473 CCCGGGTCCCGGGGCGCCGGTGG + Intronic
1061208283 9:129176801-129176823 ACAGGGACCCGGGGCCCCGCGGG - Exonic
1061680896 9:132242035-132242057 GGCGGGGCGCGGGGCGGCCCCGG - Exonic
1061866073 9:133492411-133492433 GCAGGGACTCGGGGGGCAGCGGG - Intergenic
1062022760 9:134326938-134326960 GCCGGGGCGCAGGCGGCCGCCGG - Intronic
1062162393 9:135087613-135087635 GCCGGGAGGCGGGGCTCGGCCGG - Intronic
1062269487 9:135702064-135702086 GCCGGGACCCGCGGCGGCTCTGG - Intergenic
1062282279 9:135757386-135757408 GCCGGGGCGGGGGGTGCAGCTGG + Intronic
1062364730 9:136203219-136203241 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1062596582 9:137302426-137302448 GCCGCGAAGCGCGCCGCCGCCGG - Intergenic
1187900908 X:24025754-24025776 GCCGGGACGCGGGGCGCCGCGGG - Intronic
1188004378 X:25007178-25007200 GCCGCCCAGCGGGGCGCCGCTGG - Exonic
1192491034 X:71577919-71577941 GGCGGGGCGCGGGGGGACGCGGG - Intergenic
1195217129 X:102712963-102712985 GCCGGGACGCCGACCCCCGCCGG - Intronic
1195654829 X:107324215-107324237 GGCGGGGGGCGGGGCGCCTCCGG - Intergenic
1200256432 X:154585371-154585393 GCCGGGAGGAGGCGCCCCGCGGG + Exonic
1200261337 X:154619032-154619054 GCCGGGAGGAGGCGCCCCGCGGG - Exonic