ID: 1187912618

View in Genome Browser
Species Human (GRCh38)
Location X:24124907-24124929
Sequence TTCCCAGCACAACCTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187912616_1187912618 23 Left 1187912616 X:24124861-24124883 CCTATGACTGGATAACAGAGAAA No data
Right 1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG No data
1187912615_1187912618 24 Left 1187912615 X:24124860-24124882 CCCTATGACTGGATAACAGAGAA No data
Right 1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187912618 Original CRISPR TTCCCAGCACAACCTAAAAG TGG Intergenic
No off target data available for this crispr