ID: 1187916040

View in Genome Browser
Species Human (GRCh38)
Location X:24152652-24152674
Sequence CTGTGGTTGTTGAGGTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187916040 Original CRISPR CTGTGGTTGTTGAGGTGTTA AGG Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
903406202 1:23098598-23098620 CTGAAGTTGTTGAGAAGTTAGGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904838246 1:33353642-33353664 CTGTGTTTGCTGAGGGGGTAGGG - Intronic
907136112 1:52141514-52141536 GGGTGGTGGTTTAGGTGTTAAGG + Intergenic
908368457 1:63453389-63453411 CTTTGCTTATTGAGGTGTGAAGG + Intronic
908393693 1:63706010-63706032 TTGTGGTTGGTCAGGTGTTTGGG + Intergenic
911971630 1:104445823-104445845 CTGTGGTCGTTAAGGTGTTTTGG + Intergenic
914349299 1:146826545-146826567 CTGTGTCTGTTGATGTTTTAGGG - Intergenic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
915120954 1:153629279-153629301 CTGTGGCTGATGAGGGGATAAGG - Intronic
915538237 1:156550587-156550609 CTGTGGTTCTGGAGGTGCTGTGG - Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
922615582 1:226959438-226959460 CTGATGTTGATGAGGTGTGAAGG + Intronic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
923854885 1:237835629-237835651 CTGTTGCTGTTAAGGTGTTTGGG + Intergenic
924586046 1:245362158-245362180 CTGTGCTTGATGGGGTGTGAAGG - Intronic
1063246837 10:4229244-4229266 CTGTGGTTGTTGAGGAACTATGG - Intergenic
1064078812 10:12291701-12291723 CTGTGGTTGTTGTTTTGTTCTGG + Intergenic
1067529393 10:47059512-47059534 GTAGGGTTGTTGAGGTTTTAAGG + Intergenic
1068024029 10:51620084-51620106 TAGTGTTTGTTGAGGTGTAAGGG - Intronic
1071962106 10:90817061-90817083 ATGTTGTTGCTGAGGTGGTATGG - Intronic
1073420495 10:103420379-103420401 CTGAGGTTTTTGAGGTGTTAAGG + Intronic
1073525020 10:104172688-104172710 TTGTGGTTATTGAAGTTTTAAGG + Intronic
1076439158 10:130467990-130468012 TTATGTTTGTTGAGGTTTTAAGG + Intergenic
1083222551 11:61262657-61262679 CTGTGGATGATGAGCTTTTAGGG - Intronic
1083571907 11:63765578-63765600 CTGTGGTTTTTGAAGTATCAAGG - Intronic
1085658378 11:78338720-78338742 CTGTGGTTGTTCTGGTTTGAAGG + Intronic
1085939442 11:81191271-81191293 CTATGCTTGGTGAGGTCTTAAGG + Intergenic
1087700081 11:101426850-101426872 TTGTTGTTGTTGTTGTGTTATGG + Intergenic
1088331152 11:108653535-108653557 CTGTGGTCTTTGAGGTATTTTGG - Intergenic
1088367444 11:109054283-109054305 CTGTGGTTCCTGAAGGGTTATGG + Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089491598 11:118887485-118887507 CTGTGCTGGATGTGGTGTTAGGG - Intronic
1091370096 11:135050450-135050472 CAGTGGAGGTTGAGGTGGTAGGG + Intergenic
1092982903 12:13815409-13815431 CTGTGATTGTTTTGTTGTTACGG - Intronic
1093252386 12:16822453-16822475 ATGTGGTTGTTGAGATGATTAGG + Intergenic
1093524566 12:20091887-20091909 CTGAGATTTTTGTGGTGTTAGGG + Intergenic
1097593021 12:61594330-61594352 CTGTGGTTGGTGGGGGGCTAGGG + Intergenic
1099735765 12:86564906-86564928 CAATGGTTCTTGAGGTGTCAGGG + Intronic
1101695577 12:107122617-107122639 CTGTGTTTGTTGAGAGATTAGGG - Intergenic
1101778820 12:107817445-107817467 CTGTGGTGGCTGAGGTGGAATGG + Intergenic
1102012434 12:109626806-109626828 CTGTTGTTGGTGAGGTGTTTGGG - Intergenic
1105569562 13:21588734-21588756 CTCTGGTTGATGAGATGCTAGGG - Intronic
1105797386 13:23868829-23868851 TTGTGCTAGGTGAGGTGTTACGG - Intronic
1106457411 13:29939224-29939246 CCGTGGTTATAGAGTTGTTAGGG + Intergenic
1107912358 13:45117456-45117478 TTGTGGTGGGTGTGGTGTTAGGG + Intergenic
1109243282 13:59918638-59918660 CTGTTGTTGGTGCAGTGTTAGGG - Intronic
1110205296 13:72905030-72905052 GTGAGGTTGGTCAGGTGTTAAGG - Intronic
1110632900 13:77730110-77730132 CTGTTGTGGTTGGGGTGTAATGG + Intronic
1113160812 13:107378864-107378886 CTGTTTTTAATGAGGTGTTATGG + Intronic
1113249874 13:108440627-108440649 CTGTTATTGTTGAACTGTTAGGG - Intergenic
1114700736 14:24675691-24675713 CTATGTTTGTTGAGGTATTTAGG + Intergenic
1115823252 14:37235385-37235407 CTGTGTTTGCTGCAGTGTTAGGG + Intronic
1117093916 14:52277962-52277984 CTGTGGAAGTTCAGGTGTGAGGG - Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122689944 14:103527538-103527560 CTGTGGTTGGTGTGGAGTCAGGG - Intergenic
1123901681 15:24883460-24883482 GTGTGTTTGTTGAGGGGGTAGGG - Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128839074 15:70834907-70834929 CTCTGATTTTGGAGGTGTTAGGG + Intronic
1130832618 15:87616895-87616917 CTGTGCTTCTTGAGCTGTTGAGG - Intergenic
1131550226 15:93350824-93350846 CTGTGGGTGGTGAGGAGTTGGGG + Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132577646 16:671373-671395 CTGTGGATGCTGAGGGGTTCAGG - Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138265357 16:55656288-55656310 CTGTGGCTGTTGAAGTGTCGCGG + Intronic
1139404647 16:66708252-66708274 GTGAGGTTGGAGAGGTGTTAGGG + Intergenic
1139984737 16:70889009-70889031 CTGTGTCTGTTGATGTTTTAGGG + Intronic
1141051521 16:80769085-80769107 CTGTGGTTGATGATATGTGATGG - Intronic
1141219483 16:82055859-82055881 CTGTGGTTGGTGAGGAGTACTGG + Intronic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1143768224 17:9151337-9151359 CTGTGTTTGTCGAGGGCTTAGGG - Intronic
1144191502 17:12850740-12850762 CTGTGCTTGTTAAGGTTTTGGGG - Intronic
1144851536 17:18246463-18246485 CTGGGGATGTGGAAGTGTTAGGG + Intronic
1145067951 17:19775949-19775971 ATGTGTTTGCTGAGGTGTAAAGG - Exonic
1146273081 17:31497390-31497412 TTGTGCTTGTTTAGGTGTTAAGG + Intronic
1147157546 17:38551877-38551899 CTGTGTCTGTTGAGGTGCTGGGG - Exonic
1147243432 17:39105615-39105637 CTCTGGTTGTTAAGGTGAAAGGG - Intronic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152326244 17:79640069-79640091 TTTTGGTTGTTGAGTTTTTAGGG - Intergenic
1152681644 17:81671579-81671601 CTGTGGGTTTTGGGGTGGTAAGG + Intronic
1155117640 18:22784735-22784757 CTGTAGTTGTTGGGTTGTTTAGG - Intergenic
1156146474 18:34187199-34187221 CAGTGGTTGTTATGGGGTTAAGG - Intronic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1158292772 18:55960018-55960040 CTGTGCTTGTTGTGGTGTAGGGG + Intergenic
1164085709 19:21900201-21900223 CTGTGACTTTTGTGGTGTTATGG - Intergenic
1166542571 19:43615086-43615108 CTGGGGTTGGGGAAGTGTTATGG + Intronic
1168491141 19:56810368-56810390 GTGTGGTTGTTGTGGGATTATGG - Exonic
925303006 2:2830312-2830334 GTGTGGTTTTTGAGGTGTGGGGG - Intergenic
927214314 2:20658424-20658446 CTGTGGTTATATAGGTGATATGG - Intergenic
929375444 2:41281486-41281508 CTGTGGTTATAGAAGTGTTAGGG + Intergenic
930751496 2:54938903-54938925 CTGTGATTGTTCAGTTCTTAAGG - Intronic
932170133 2:69547398-69547420 TTGTTGTTGTTGAGTTGTAAGGG - Intronic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
933658774 2:84909605-84909627 GTGTGGTGGTTGAGGTGTGATGG - Intergenic
934519405 2:95010501-95010523 GTGGGGTGGTTGAGGGGTTAAGG - Intergenic
935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG + Intergenic
936249520 2:110857114-110857136 CTCTGGTCCTTGAGGTGTCACGG - Intronic
939825223 2:147007247-147007269 CTGGGGTTGTTGGGGAGATAAGG + Intergenic
942488980 2:176470832-176470854 CTGTGGTTGATGAGGTCTAGTGG - Intergenic
942747038 2:179245788-179245810 CTGTAGTTGTTGCTATGTTAGGG - Intronic
943298191 2:186164321-186164343 CTGTGGTGGTGGGGTTGTTAGGG - Intergenic
945653606 2:212595960-212595982 TTGGGGTTGTGGTGGTGTTAGGG - Intergenic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
948030080 2:234810180-234810202 CTGTGTTAGATGAGGTGTTCAGG - Intergenic
1169280038 20:4259228-4259250 ATGTGGGTGTTGGGGAGTTATGG + Intergenic
1169585196 20:7074170-7074192 CTTTGGTTGTTGAGTTGTAAAGG + Intergenic
1169690652 20:8327243-8327265 ATTTGGTTGTTGAGGTGTCCAGG + Intronic
1170031312 20:11947170-11947192 CTGTGGTTGCTCAGGTCTTTTGG + Intergenic
1171299078 20:24043628-24043650 CTGTGGTCCTTGAGGTATTTTGG + Intergenic
1172441231 20:34967994-34968016 CTGTGGGTGTTGGGGTACTATGG - Intergenic
1173448758 20:43143623-43143645 CTGTGTTTGTCCAGGTGTTAAGG + Intronic
1175078152 20:56393081-56393103 CTGTGGGAGTTGAGAAGTTAGGG + Intronic
1175782056 20:61689196-61689218 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782064 20:61689232-61689254 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782072 20:61689268-61689290 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782087 20:61689340-61689362 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782095 20:61689376-61689398 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782103 20:61689412-61689434 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782118 20:61689484-61689506 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782126 20:61689520-61689542 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782134 20:61689556-61689578 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782149 20:61689628-61689650 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782184 20:61689808-61689830 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782191 20:61689844-61689866 CGGTGGTTGGTGAGGTGATGTGG + Intronic
1175782198 20:61689880-61689902 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175782205 20:61689916-61689938 CGGTGGTTGGTGAGGTGATGTGG + Intronic
1175782259 20:61690171-61690193 CAGTGGTTGGTGAGGTGATGTGG + Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1179077080 21:38132604-38132626 GTGTGGTATTAGAGGTGTTAGGG - Intronic
1181868918 22:25882402-25882424 TTCTGGCTATTGAGGTGTTAGGG + Intronic
1182730387 22:32485379-32485401 ATGAGGTTGTTGAGTTGTTTAGG + Intronic
950332806 3:12169884-12169906 CTGTGGCTGCTGGGTTGTTAGGG - Exonic
950616098 3:14159413-14159435 CTGTGGATTTTGAGGTGGTCTGG - Intronic
955253855 3:57309398-57309420 CTGTGGTTGTGGATGAGCTAAGG - Intronic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
960854925 3:122092838-122092860 CTGTGGATGATGAGGAGTCAGGG + Intronic
960855807 3:122101030-122101052 CAGTGGTTGGTGAGGTGCTATGG + Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962563243 3:136630312-136630334 TTGAGATTGTTGAGGTGTTCCGG - Intronic
964750696 3:160051291-160051313 TTGTGGTTTTTGAGGGGTGAAGG + Intergenic
965016078 3:163158688-163158710 CTGAGATTTTTGAGGGGTTATGG - Intergenic
966744507 3:183262938-183262960 CTGGGGTTGTTGGGGTGGGAGGG + Intronic
967955275 3:194872986-194873008 CTGTGGTTGCTGAGATTTTTTGG - Intergenic
969349055 4:6587563-6587585 CTGTGATTCTTCAGGTGTGAGGG + Intronic
969470927 4:7388886-7388908 CTCTGGTTGTTGTGGTGTTGTGG + Intronic
971177993 4:24299711-24299733 CTGTAGTCGTTTATGTGTTAGGG - Intergenic
973739920 4:53909944-53909966 TTATGGTTGTTGATGTATTACGG - Intronic
974660609 4:64883500-64883522 CTGTGGTTTATGAGGTGGAAAGG - Intergenic
979033418 4:115680388-115680410 GTGTGCTTGTCAAGGTGTTATGG + Intergenic
979322450 4:119340424-119340446 ATGTGATTTTTGAGGTGTTCAGG + Intergenic
979485176 4:121262720-121262742 CCCTGCTTGTTCAGGTGTTAGGG - Intergenic
979643574 4:123039434-123039456 GTGTTTTTGTTGAGGGGTTAGGG - Intronic
980748088 4:137047908-137047930 CTCTGGTTGTTAAGGTCTTCTGG - Intergenic
982539387 4:156648911-156648933 GTGTGTGTGTTGAGGTGTTGGGG - Intergenic
983047968 4:163009789-163009811 CCGTGGTAATTCAGGTGTTAAGG - Intergenic
983240429 4:165226037-165226059 ATGTGATTTTTGAGGTGTTCAGG + Intronic
988959477 5:36355345-36355367 CTCTGGTTTTTGAGGTGCAATGG - Intergenic
994328195 5:98474174-98474196 CATTGGATGTTGAGATGTTATGG - Intergenic
994438392 5:99768237-99768259 TTGATGTTGTTTAGGTGTTACGG + Intergenic
994946858 5:106405045-106405067 CTGTCTTTGTGCAGGTGTTATGG - Intergenic
997890583 5:137672904-137672926 TGGTGGGTGTTGAGGGGTTAGGG - Intronic
999499226 5:152130171-152130193 CTGTGGTTATTGTGGTGGGAGGG - Intergenic
1001667069 5:173442042-173442064 CTGTGGTGGTGGTGGTGTTATGG - Intergenic
1005681035 6:28208260-28208282 TTGTTGTTGTTAAGGTGTGAGGG + Intergenic
1005932121 6:30491615-30491637 CTGTGGTTGCTGCTGTGATATGG + Exonic
1007314056 6:40970267-40970289 CTGTGGCAGTTGGGGTGCTAAGG + Intergenic
1008147576 6:47910354-47910376 CTGTGGTTGTTCAAGTTATAGGG - Intronic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1013149743 6:107432942-107432964 TTGTGGTTATTGGGGTGGTAGGG - Intronic
1014169671 6:118265047-118265069 CTGAGGTTGCTGAGATGATAAGG - Intronic
1019863021 7:3677927-3677949 CTGTTGTTGTTGAGTTGTAGGGG - Intronic
1021437357 7:20634761-20634783 TTGTCATTGTTGAGGTGTTTGGG + Intronic
1021940727 7:25676431-25676453 TTGTGATTTTTGAGGGGTTAAGG - Intergenic
1022809146 7:33851921-33851943 CTGTGGTTAGTGAGATGGTAGGG + Intergenic
1023645974 7:42315388-42315410 CTTTTGTTGTTGAGGAGTTGTGG - Intergenic
1027240241 7:76322726-76322748 CTGTGGTCAGTGAGGAGTTAGGG - Intergenic
1028257555 7:88618623-88618645 CTGTACGTGTTTAGGTGTTATGG + Intergenic
1028709845 7:93894279-93894301 CTGTGGTCATAGAGGTTTTAAGG - Intronic
1028716722 7:93979527-93979549 ATGTGGTTGCTGATGTGTCATGG - Intronic
1028879102 7:95859542-95859564 CTGTGGCTGATGTGGTGTTGGGG + Intronic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1032432808 7:131875887-131875909 CTGTGCATGTTGAAGTGGTATGG - Intergenic
1033301133 7:140186853-140186875 CTGTGGTTGTTGATATAGTAGGG - Intergenic
1033810041 7:145001794-145001816 CTGTGGTAGTAGAGGTCTTTGGG + Intergenic
1036617654 8:10401191-10401213 TTGTGGTTGTTGAGTTGTATGGG - Intronic
1037164218 8:15807334-15807356 TTGTGGTTGTTGACTTGTTTTGG - Intergenic
1037529625 8:19759969-19759991 CTTTGGTCTTTGAGGTGTAAAGG - Intergenic
1037584749 8:20268739-20268761 CTGAGGTTGCTGAGGTGCTGGGG + Intronic
1039624532 8:39034714-39034736 ATGTTGTTGTTGAGATGTCAAGG + Intronic
1040854849 8:51937999-51938021 TTTTTGTTGTTGAGTTGTTAGGG + Intergenic
1043846505 8:85169873-85169895 CTTTTTTTGTTGAGGTATTAGGG + Intergenic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1050721535 9:8596851-8596873 CTTTGGTTTTTAAGGTGCTATGG + Intronic
1051331100 9:16025767-16025789 CAGTGGTTGCTGAGATCTTAGGG + Intronic
1055839632 9:80487334-80487356 CTGTGATATTTGAGGTGTGAAGG - Intergenic
1055933098 9:81580015-81580037 CTGTTGTTTGTGAGGTGATAGGG - Intergenic
1059397940 9:114050375-114050397 CTGTGGTTGTGGGGGTGTGGGGG + Exonic
1060037643 9:120270856-120270878 CTAGGGTTTTTGTGGTGTTAGGG + Intergenic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1186446570 X:9635090-9635112 CTGTGGCTGCTGAGTTGGTATGG + Intronic
1187319243 X:18225871-18225893 CTGTGGTTGTTGGGGAGTGGGGG - Intergenic
1187794802 X:22992065-22992087 ATGGGGTTGTAGAGGTGTAAAGG - Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1190222351 X:48520585-48520607 GTGTGTGTGTTGAGGTGTTGGGG - Exonic
1191728590 X:64308816-64308838 ATGTGGATGTTGAGTTGTTCTGG + Intronic
1192765842 X:74138842-74138864 CTGTGGTTGGGGAGGAGTTTGGG - Intergenic
1193266232 X:79472809-79472831 CTTTAGCTGTTGAGGTGTTAAGG - Intergenic
1193704961 X:84810153-84810175 CTGGGGTTTTTGTGGTTTTAGGG + Intergenic
1195836392 X:109119401-109119423 CTGAGGGTGTTGAGATGTGATGG - Intergenic
1196644858 X:118106932-118106954 CTATGGATTTTGAGTTGTTATGG - Intronic
1197303153 X:124805735-124805757 CTGTGGCCGTTGTGGTGCTAGGG - Intronic
1199106005 X:143869197-143869219 TTGTGGTTGTGGTGGTGATAAGG - Intergenic
1199153175 X:144514119-144514141 CAGTGGTTGTTTAGCTGCTAAGG - Intergenic
1200758690 Y:7016151-7016173 CTGTGGCTGCTGAGTTGGTATGG + Intronic