ID: 1187919891

View in Genome Browser
Species Human (GRCh38)
Location X:24191404-24191426
Sequence CTCCTCAGGAACCCTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187919891_1187919894 -9 Left 1187919891 X:24191404-24191426 CCACAAAGAGGGTTCCTGAGGAG 0: 1
1: 0
2: 1
3: 14
4: 171
Right 1187919894 X:24191418-24191440 CCTGAGGAGGAAGTTAAGAGAGG 0: 1
1: 1
2: 0
3: 23
4: 285
1187919891_1187919895 -5 Left 1187919891 X:24191404-24191426 CCACAAAGAGGGTTCCTGAGGAG 0: 1
1: 0
2: 1
3: 14
4: 171
Right 1187919895 X:24191422-24191444 AGGAGGAAGTTAAGAGAGGAAGG 0: 2
1: 0
2: 11
3: 104
4: 1276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187919891 Original CRISPR CTCCTCAGGAACCCTCTTTG TGG (reversed) Intronic
900137003 1:1121928-1121950 AGCTTCAGGAACCCTCTGTGTGG + Intergenic
901451281 1:9338269-9338291 CTCCCCAGGACCCCTTTGTGGGG + Intronic
904228127 1:29041880-29041902 TTCCTCATGAAAACTCTTTGAGG - Intronic
905018935 1:34795235-34795257 CTTCTCAGGACCCCTCTGTTGGG - Exonic
907590066 1:55658091-55658113 AGCCTCAGGACCGCTCTTTGAGG + Intergenic
907950834 1:59182161-59182183 CTCATTAGGATCCCTCTTGGAGG - Intergenic
908024035 1:59928939-59928961 CTTCTCAGGAATAGTCTTTGAGG - Intergenic
908527100 1:64999080-64999102 CTCCTCAGGAATGATTTTTGGGG + Intergenic
912429471 1:109621357-109621379 CTCCTCCGGCATCCTCTCTGTGG + Intronic
912798222 1:112705643-112705665 TTCCCAAGGAACCCTCTTTTTGG - Exonic
915889903 1:159763671-159763693 ATTCTCAGGAACACTTTTTGTGG + Intergenic
917538426 1:175891273-175891295 CTCCTCAGGGCCCCTCTGTAAGG + Intergenic
917579016 1:176355205-176355227 CTTCTCAGGAGCCCTCCTTGGGG - Intergenic
917637160 1:176948598-176948620 CTTCTCAGGATCACTCTGTGAGG - Intronic
918344331 1:183593140-183593162 CTCCTGAGGCACACTATTTGAGG - Intronic
920210419 1:204324161-204324183 GACTTCAGGAGCCCTCTTTGGGG + Intronic
920331596 1:205211939-205211961 CTCCTCAGGGACGCTCATAGAGG - Intergenic
920348554 1:205322346-205322368 CGCCTAAGAAGCCCTCTTTGAGG - Intergenic
923709842 1:236378430-236378452 CTCCCCAGGAACCAGCTCTGGGG - Intronic
1062968302 10:1626942-1626964 CTCCTAAGAATCCCTCTCTGTGG + Intronic
1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG + Intronic
1070510704 10:77158175-77158197 ATCCTCAAGAATCTTCTTTGAGG + Intronic
1075704024 10:124488208-124488230 CTCCTCATAAGCCCTCTCTGAGG + Intronic
1077488014 11:2847985-2848007 CTCCTCAGGACCCCTCATCGGGG - Exonic
1084477666 11:69398229-69398251 CTCCTTAGGATCCCTCCTTAAGG + Intergenic
1086582898 11:88420034-88420056 CTCCTCAGGAAACCAGTTTCAGG + Intergenic
1090379970 11:126319524-126319546 CTCCCCAGGAAGCATCTTGGAGG + Intronic
1090533005 11:127610705-127610727 CTCTGCAGGAATCCTGTTTGTGG + Intergenic
1092497128 12:9007665-9007687 CTCTTCAGCAACCATCTTTCAGG + Intronic
1096590885 12:52658596-52658618 CTTCCCAGGACCCCTCTTTCAGG + Intergenic
1096787804 12:54027687-54027709 CTTCTCAGGACCCCTCTGTTGGG - Intronic
1099972627 12:89515649-89515671 CTCCTCAGCAACCCATTCTGAGG + Intronic
1101807864 12:108080645-108080667 ATCCTCAGGAACGCTCTTTGAGG - Intergenic
1102583882 12:113909778-113909800 CACGTCAGGAACACTGTTTGGGG - Intronic
1103902712 12:124311668-124311690 CCCATCAGGAAGCCGCTTTGTGG - Intronic
1105322820 13:19344867-19344889 CGCCTCCGGAACCCTATATGAGG + Intergenic
1105874793 13:24541848-24541870 CGCCTCCGGAACCCTATATGAGG - Intergenic
1106141428 13:27015163-27015185 CTCCTCAAGTCCCCTCTCTGTGG - Intergenic
1108917778 13:55636913-55636935 CTCCTCTGGTTCCCTCTTGGTGG - Intergenic
1113840547 13:113357468-113357490 CTCTTAAGAAACCCTCTTTCTGG + Intronic
1117211636 14:53506938-53506960 CTCTGCAGGCTCCCTCTTTGTGG + Intergenic
1117499780 14:56340017-56340039 CTCCTCAGCCACCCTCACTGGGG + Intergenic
1120162571 14:81161582-81161604 CTCCTCAGTCAAACTCTTTGAGG + Intergenic
1121453164 14:94022281-94022303 CTCCTCTGGTGCCCTCTCTGGGG + Intergenic
1123880908 15:24676760-24676782 CTCATCAGGCATCCTCTTTCCGG - Exonic
1125537905 15:40453134-40453156 CTCCTAAGGAAGACTCTTTTTGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128312011 15:66636706-66636728 CCACACAGAAACCCTCTTTGGGG - Intronic
1128318042 15:66673512-66673534 CTCCTCAGGCACCCGCTCTGGGG + Intronic
1129162509 15:73754285-73754307 CTTCTCAGGAAACCCCTCTGGGG + Intergenic
1129254478 15:74326429-74326451 CTCCACAGCAACCCCCCTTGGGG + Intronic
1130222866 15:82035856-82035878 CTCCTCAGAAAAACTCTTTGAGG + Intergenic
1132591849 16:729531-729553 CACCTCTGGAACCTTCTTCGAGG + Exonic
1135504251 16:23022396-23022418 CTCTTCAGAGACCCTCTGTGGGG - Intergenic
1135739702 16:24964268-24964290 ATCCTCAGGAACCAACTTTCAGG - Exonic
1136534620 16:30892617-30892639 CTCCTCAGGGACCCCTTCTGGGG + Exonic
1138277884 16:55749553-55749575 CTTCTGAGGCACCCTCTGTGGGG - Intergenic
1138283876 16:55793400-55793422 CTTCTGAGGCACCCTCTGTGGGG - Intergenic
1138285126 16:55803587-55803609 CTTCTGAGGCACCCTCTGTGGGG + Exonic
1138407654 16:56810733-56810755 CGCCCCAGAAATCCTCTTTGTGG + Intronic
1138407662 16:56810773-56810795 CGCCCCAGAAATCCTCTTTGTGG + Intronic
1138547293 16:57727490-57727512 CTGCTGAGAAACCCTCTGTGGGG + Intronic
1140116042 16:72042405-72042427 GCACTCAGGAAACCTCTTTGTGG - Intergenic
1141202645 16:81909818-81909840 CTCTTCAGGATGCCTCTTTGAGG + Intronic
1142421508 16:89973110-89973132 CTCCTCGCGAACCAGCTTTGTGG + Intergenic
1144711548 17:17404586-17404608 CTCATCAGGCACAGTCTTTGAGG + Intergenic
1146682298 17:34816880-34816902 CTCCTCTGCAATCCTCTTTCTGG - Intergenic
1147243743 17:39107511-39107533 CTCCCCAGGGACAGTCTTTGTGG - Exonic
1147676713 17:42211578-42211600 TTCATCAGCATCCCTCTTTGTGG + Intronic
1148866072 17:50629364-50629386 CTCCCCAGCAGCCCTCTCTGTGG + Intergenic
1149212351 17:54318015-54318037 CTCCTCAAGGACTATCTTTGTGG - Intergenic
1151383756 17:73742900-73742922 TTCCTCCGTAACCCTCTTTCAGG - Intergenic
1156116813 18:33795543-33795565 CTGCTATGCAACCCTCTTTGGGG + Intergenic
1159875929 18:73811151-73811173 CTCATCAGGAACACTCATTTGGG - Intergenic
1160390501 18:78527719-78527741 CTCCTCAGGCATCCTCTATGCGG + Intergenic
1160514533 18:79471088-79471110 CCGCTCAGGAAGCCTCTCTGTGG - Intronic
1161154650 19:2726414-2726436 CTCCTCAGGAGCAGTCTCTGGGG - Intronic
1161300943 19:3543052-3543074 CTCCTCAAGCACCCACTCTGGGG + Intronic
1162334667 19:10052999-10053021 ATCCCCAGGCACCCTCTTGGAGG - Intergenic
1163163646 19:15480473-15480495 CTCCTCAGGTGTCCTCTTTCTGG + Intronic
1164721037 19:30431742-30431764 CTCCGCAGGACCCCTCCCTGGGG - Intronic
1164912376 19:32023386-32023408 CTGCTCAGTAACCCTCAGTGAGG + Intergenic
1165075961 19:33280011-33280033 CACCGCTGGAGCCCTCTTTGTGG - Intergenic
1165838486 19:38773307-38773329 TTCCTCTGGGGCCCTCTTTGAGG - Intronic
1165841073 19:38789390-38789412 TTCCTCTGGGGCCCTCTTTGAGG + Intronic
1166136353 19:40779347-40779369 ATCCTCAGGAAAACTCTATGAGG - Intronic
1167635977 19:50656042-50656064 GTCCTCAGGAGCCCTCCTTATGG + Exonic
927874429 2:26645555-26645577 CTCTGCAGGAACCCTCTGTGTGG + Intergenic
928452441 2:31388618-31388640 TTCCTCAGGAAGCGTCTATGAGG + Intronic
930185811 2:48411051-48411073 ATCCTCAGGGACCCACCTTGAGG + Intergenic
930613283 2:53566687-53566709 CTACTCAGAGAACCTCTTTGTGG - Intronic
932010873 2:67976269-67976291 CTCCTCTGAAACCATCTTTGTGG - Intergenic
932346041 2:70995556-70995578 CCCCTCAGGAACCCTCCCAGAGG - Intergenic
932689111 2:73897325-73897347 CCCCTCAGCAACCCTCTCTCCGG - Intronic
934049378 2:88197774-88197796 CTGCCCAGGTTCCCTCTTTGGGG + Intergenic
935187655 2:100748454-100748476 TGGCTCAGGAAGCCTCTTTGTGG + Intergenic
939124337 2:138157421-138157443 CTCCTCTGGATCCCTCTTGCTGG - Intergenic
939346272 2:140970012-140970034 CTTCTCAAGGACCATCTTTGGGG + Intronic
940155350 2:150650626-150650648 CTGCTCAGGTTCCCTCTCTGCGG + Intergenic
943826978 2:192407838-192407860 TGCCTCAGTAACCCCCTTTGAGG - Intergenic
943975996 2:194478438-194478460 CTTCTCAGGAATTCTCTTTAAGG - Intergenic
946400908 2:219468102-219468124 CTCCTCCAGAAGCTTCTTTGAGG + Intronic
947126055 2:226869661-226869683 CTCCTCACGATGCCTATTTGGGG - Intronic
948353948 2:237362294-237362316 CTGCTCTGGAAGCCTCTTTCTGG - Intronic
948790054 2:240372394-240372416 CTCCGCAAGAAACCTCTGTGGGG - Intergenic
1174389658 20:50210368-50210390 GTGCTCAGGAACACTCTTTGAGG + Intergenic
1174631537 20:51962609-51962631 ATCCTCAGGACATCTCTTTGAGG + Intergenic
1175273516 20:57751623-57751645 CTCCACAGAAATCCTCTGTGTGG - Intergenic
1176285310 21:5016231-5016253 CTCCTCAGGCACCCTCCCTAGGG - Intergenic
1179871871 21:44247244-44247266 CTCCTCAGGCACCCTCCCTAGGG + Intronic
1182347839 22:29679256-29679278 ATCCTCAGGAAAACCCTTTGGGG + Intronic
950515088 3:13459987-13460009 CTGAACAGGAAACCTCTTTGGGG - Intergenic
951555501 3:23917085-23917107 CACCTCAGCCACCCTCTTTCCGG - Exonic
952832536 3:37577032-37577054 CCCCTCAGGACCCATCCTTGGGG + Intronic
955775253 3:62425919-62425941 CTCCTGGGGCACCTTCTTTGAGG + Intronic
956650710 3:71502019-71502041 CTCATCAGGAAGGCTCTTTTGGG + Intronic
957604993 3:82386928-82386950 CTACTCAGGAAGCCCCTTTCAGG - Intergenic
961092830 3:124129761-124129783 TTCCCCAGGAAACCTCTTTTGGG + Intronic
961812887 3:129531938-129531960 CTCCTCACCAACCCTCTGCGTGG + Intronic
964631887 3:158819580-158819602 CTCCTTAGGAACCTTCTGTTTGG + Intronic
964677867 3:159303695-159303717 CTGCTCAGGAATCCTCTTGTTGG - Intronic
966206428 3:177411081-177411103 CTCCTCAGAAAATCTCTCTGAGG - Intergenic
968614605 4:1571687-1571709 CTCCTCAGCAAGCCGCTTGGGGG + Intergenic
968673287 4:1863816-1863838 CTCTCCAGGAAGCATCTTTGTGG + Intergenic
968816094 4:2822759-2822781 CTCCCCAGGAGCCCACTCTGGGG - Intronic
968967246 4:3775367-3775389 CTCGTGACGAAGCCTCTTTGGGG + Intergenic
969969750 4:11033600-11033622 CTCATTGGGAACCATCTTTGTGG + Intergenic
971371242 4:26020799-26020821 TTGTTCAGGAACCCTCTTTTGGG + Intergenic
973280017 4:48350226-48350248 CTCCTCAGTCCCCATCTTTGGGG + Intronic
979687677 4:123528398-123528420 CTGCTCAGGTACCCACTGTGGGG + Intergenic
981747336 4:148064190-148064212 TTCCTCAGGGAGCCTCTCTGAGG - Intronic
982355641 4:154464837-154464859 CTCCTCAGGAACAGCCTTTAGGG - Intronic
983574822 4:169249376-169249398 CTCCAGAGGAACCATCTTGGAGG + Intronic
985833060 5:2250093-2250115 CTACTCTGCAACCCTCTTTCAGG - Intergenic
986098501 5:4583988-4584010 ATCCTCAGGAAACATCTGTGAGG + Intergenic
990225138 5:53642249-53642271 CTCCACAGGAACCTCCTTTTTGG - Intronic
996161690 5:120174232-120174254 CACCTCAGGGACCCACTTGGGGG + Intergenic
997243186 5:132323554-132323576 TTCCTCTGGAACCCTGTCTGAGG + Intronic
997759679 5:136433135-136433157 CCCCTCAGGACCCCCCTTTCTGG + Intergenic
999114732 5:149152661-149152683 CTCCTCAGACGCCCTCTTTTGGG - Intronic
1002762362 6:211824-211846 CTCTTCAGGAACCCTGTTAGTGG + Intergenic
1002965959 6:1966725-1966747 AGCTTCAGGAACCCTGTTTGGGG - Intronic
1003499510 6:6693050-6693072 CTCCACAGGAACTCCATTTGAGG + Intergenic
1006674169 6:35750287-35750309 CTCCTCAGAGCCCATCTTTGAGG - Intergenic
1007724760 6:43908630-43908652 CTCCCCAGGCACCCTCATTCCGG + Intergenic
1007796552 6:44353334-44353356 CTCCCCAGAAACCATCTGTGTGG - Intronic
1008270455 6:49483497-49483519 CTGCACAGGAACCCTCTGAGGGG + Intronic
1011474471 6:87737367-87737389 CTGCTCAGGCAGTCTCTTTGTGG - Intergenic
1013570024 6:111413268-111413290 CTCATCAGGGAGACTCTTTGGGG + Intronic
1013860717 6:114632490-114632512 CTTCTCAGGGAGACTCTTTGTGG + Intergenic
1013921213 6:115406827-115406849 GTCCTCAGGAACAATTTTTGGGG + Intergenic
1024766644 7:52668503-52668525 CCACTCAGGAACCCTGTGTGTGG - Intergenic
1025112952 7:56234876-56234898 TTCCTCAGGAAGTCTCTTTGAGG + Intergenic
1032879896 7:136077820-136077842 CTCCTCTGCCAGCCTCTTTGGGG - Intergenic
1035751129 8:1997186-1997208 CTCCTCAGGGAGCCTCTTAGTGG + Intronic
1035904308 8:3492386-3492408 CTACTGAGGATGCCTCTTTGTGG - Intronic
1037540052 8:19862308-19862330 CTCCTCAGCCACCCTGGTTGTGG + Intergenic
1040205255 8:44922634-44922656 ATTCTCAGGAAACTTCTTTGTGG + Intergenic
1040220229 8:45144164-45144186 ATTCTCAGGAAACTTCTTTGTGG + Intergenic
1040255513 8:45664189-45664211 ATTCTCAGGAAACTTCTTTGTGG + Intergenic
1041983418 8:63890849-63890871 CTCTCCCGGAACCCTGTTTGTGG - Intergenic
1042096766 8:65224728-65224750 CTCCTGAGGATCTCTCCTTGTGG + Intergenic
1045988986 8:108283991-108284013 GTCCTCTGGAACCTTCCTTGGGG + Intronic
1046753061 8:117945324-117945346 ATCATCAGGACCCCTCTCTGAGG + Intronic
1047237722 8:123056994-123057016 CTCCTCGGGCACCCTCCCTGAGG - Intronic
1047254685 8:123206601-123206623 CTCCTCAGGGAGCCTCTAAGGGG + Intronic
1049518005 8:143072374-143072396 GTCCTCGGGATTCCTCTTTGAGG + Intergenic
1050018743 9:1262164-1262186 CTCCCCAGGAAGCATCTCTGTGG + Intergenic
1050476835 9:6049177-6049199 CAGCTCAGGGACCCTTTTTGTGG + Intergenic
1051577998 9:18639303-18639325 CTCCACAGGAACTTTCCTTGTGG + Exonic
1053718792 9:40924086-40924108 CTCTTCTGGAATCCTCTGTGAGG - Intergenic
1055113746 9:72585567-72585589 ATCCTCATGACCTCTCTTTGTGG - Intronic
1057744085 9:97737749-97737771 CTCCTCAGGAAGTCTGTATGTGG + Intergenic
1059735407 9:117095049-117095071 CTTCTCAGCACACCTCTTTGTGG + Intronic
1059852965 9:118364177-118364199 CTGCTATGAAACCCTCTTTGGGG + Intergenic
1060546989 9:124467713-124467735 CTCCTCAGGGCCTCTCTGTGTGG - Exonic
1061264632 9:129497838-129497860 GTCCTCAGGCACCCTCTTCAGGG - Intergenic
1062029496 9:134355865-134355887 CTCCGCAGGTACCCTCTCAGTGG + Intronic
1062184321 9:135209428-135209450 TTTCTCAGGAAGCCTCTTCGAGG + Intergenic
1062194766 9:135266816-135266838 AGCCTCAGGAACCCACTTTGTGG + Intergenic
1203457155 Un_GL000219v1:179041-179063 CTATTCAGGAATCCTCTGTGAGG + Intergenic
1187919891 X:24191404-24191426 CTCCTCAGGAACCCTCTTTGTGG - Intronic
1188107190 X:26159657-26159679 CTCCTCAGTTACCATCTTAGGGG - Intergenic
1191717851 X:64205419-64205441 CTCCTTTGGAACCCGCTTTGCGG - Intronic
1195463003 X:105148586-105148608 CAACTCAGAAACCCTCTTTAAGG - Intronic
1196616397 X:117770821-117770843 CTCCTCAGGGTACCTCTTTAAGG - Intergenic
1199743915 X:150760007-150760029 CTGCTCAGCAACCCCCTGTGAGG - Intronic