ID: 1187924741

View in Genome Browser
Species Human (GRCh38)
Location X:24239324-24239346
Sequence GTGTTTAAGTAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187924737_1187924741 -4 Left 1187924737 X:24239305-24239327 CCCACCGTGACAGGCTTCTGTGT No data
Right 1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG No data
1187924736_1187924741 -3 Left 1187924736 X:24239304-24239326 CCCCACCGTGACAGGCTTCTGTG No data
Right 1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG No data
1187924733_1187924741 27 Left 1187924733 X:24239274-24239296 CCAGGAGGCTGCCTTGGAAGGGC No data
Right 1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG No data
1187924738_1187924741 -5 Left 1187924738 X:24239306-24239328 CCACCGTGACAGGCTTCTGTGTT No data
Right 1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG No data
1187924734_1187924741 16 Left 1187924734 X:24239285-24239307 CCTTGGAAGGGCGCAAGCTCCCC No data
Right 1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG No data
1187924739_1187924741 -8 Left 1187924739 X:24239309-24239331 CCGTGACAGGCTTCTGTGTTTAA No data
Right 1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187924741 Original CRISPR GTGTTTAAGTAGAAGGAAGA AGG Intergenic
No off target data available for this crispr