ID: 1187930410

View in Genome Browser
Species Human (GRCh38)
Location X:24288531-24288553
Sequence CAAAGGGTGTGGATCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187930404_1187930410 11 Left 1187930404 X:24288497-24288519 CCACTCAGCAACAGCGCGTTACA No data
Right 1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG No data
1187930403_1187930410 27 Left 1187930403 X:24288481-24288503 CCTGCAGCTGGTTGAGCCACTCA No data
Right 1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG No data
1187930402_1187930410 28 Left 1187930402 X:24288480-24288502 CCCTGCAGCTGGTTGAGCCACTC No data
Right 1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187930410 Original CRISPR CAAAGGGTGTGGATCCCAGG AGG Intergenic
No off target data available for this crispr