ID: 1187933536

View in Genome Browser
Species Human (GRCh38)
Location X:24314555-24314577
Sequence CCCGCCTGGGGGTGTTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187933527_1187933536 29 Left 1187933527 X:24314503-24314525 CCACAGGCTTGTGGCAAGCGTCA No data
Right 1187933536 X:24314555-24314577 CCCGCCTGGGGGTGTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187933536 Original CRISPR CCCGCCTGGGGGTGTTCATG TGG Intergenic