ID: 1187933536 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:24314555-24314577 |
| Sequence | CCCGCCTGGGGGTGTTCATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187933527_1187933536 | 29 | Left | 1187933527 | X:24314503-24314525 | CCACAGGCTTGTGGCAAGCGTCA | No data | ||
| Right | 1187933536 | X:24314555-24314577 | CCCGCCTGGGGGTGTTCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187933536 | Original CRISPR | CCCGCCTGGGGGTGTTCATG TGG | Intergenic | ||