ID: 1187954180

View in Genome Browser
Species Human (GRCh38)
Location X:24499615-24499637
Sequence ATGTTCCATAAGAAGAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187954177_1187954180 13 Left 1187954177 X:24499579-24499601 CCACATAGTTATGAGACTGAACA 0: 1
1: 0
2: 0
3: 3
4: 147
Right 1187954180 X:24499615-24499637 ATGTTCCATAAGAAGAACTAGGG 0: 1
1: 0
2: 1
3: 13
4: 199
1187954178_1187954180 -10 Left 1187954178 X:24499602-24499624 CCTGACTTAATAGATGTTCCATA 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1187954180 X:24499615-24499637 ATGTTCCATAAGAAGAACTAGGG 0: 1
1: 0
2: 1
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187954180 Original CRISPR ATGTTCCATAAGAAGAACTA GGG Intronic
900876531 1:5346691-5346713 ATGTTTCATGGGAAGAACCAAGG + Intergenic
903288249 1:22290582-22290604 ATATTCCATAAGAAAAAAGAAGG + Intergenic
904931558 1:34091403-34091425 ATTTTACAGACGAAGAACTAAGG + Intronic
905391739 1:37640126-37640148 ATGCCCCATATGAAGAGCTATGG - Intergenic
905845774 1:41230235-41230257 ATGGTCCAAAAGAAGAACTATGG + Intronic
907646173 1:56245784-56245806 TTGTTCCACACTAAGAACTAAGG + Intergenic
908499223 1:64726266-64726288 ATTTTTTAAAAGAAGAACTATGG - Intergenic
908887593 1:68807681-68807703 ATTTTAAATAAGAACAACTAAGG + Intergenic
909816660 1:80002939-80002961 ATGGTCCCTAAGGAAAACTATGG + Intergenic
910100483 1:83570049-83570071 ATGAACCATAAGAAAAACTAGGG + Intergenic
910375535 1:86565630-86565652 ATTTACCATAATAAGAATTATGG - Intronic
910475527 1:87602212-87602234 ATGTCCCAGTAGAACAACTATGG - Intergenic
911086894 1:93986146-93986168 ATTTTCCCTAAAAAGAACCAGGG + Intergenic
912707555 1:111926256-111926278 ATGGTACATAAGAACAACTGTGG + Intronic
913199755 1:116486043-116486065 AAGCTCCCTAAGAACAACTAAGG + Intergenic
917428674 1:174942578-174942600 ATTTTACAGAAGAAGAACAAAGG - Intronic
918285271 1:183048208-183048230 TTGTTCCGTAAGAAGAAACAAGG - Intronic
919434952 1:197546445-197546467 ATTTTCCAGAAGAAGAAATTAGG - Intronic
919522400 1:198604797-198604819 ATAATCCATAAGAAAAACTCTGG - Intergenic
920761564 1:208787957-208787979 AAGTTACATAAGAAAAGCTAGGG + Intergenic
1065260318 10:23917045-23917067 ATATTCTATAAGAAGAAAAAAGG - Intronic
1068187889 10:53610833-53610855 ATTTTCCAGAAGAAGACATATGG - Intergenic
1069072910 10:64008091-64008113 ATATTCCCCAAGAAGAACCAGGG + Intergenic
1069478216 10:68756111-68756133 ATGTACCAAAAGAGGAACTATGG + Intronic
1071238633 10:83679048-83679070 ATCTTTCATAAGAAGCAATAAGG - Intergenic
1071346166 10:84696017-84696039 ATGTTCCCTCTGCAGAACTAGGG - Intergenic
1072100675 10:92226693-92226715 ATGTAGCATAAGAGGAATTAGGG + Intronic
1072628656 10:97130905-97130927 ATGTTCCCTGAGAAAATCTAGGG - Intronic
1072834183 10:98693744-98693766 ATGTGCCATAAAAACAACTTTGG + Intronic
1074440798 10:113475867-113475889 AATTTCCAAAAGAAGGACTAAGG - Intergenic
1078460703 11:11513221-11513243 ATATTACAGAAGAAGAACTGAGG - Intronic
1078498495 11:11843901-11843923 ATGGTCCATAAAAAGAAGAAAGG - Intronic
1078955395 11:16188688-16188710 AGGTACTATAACAAGAACTAAGG + Intronic
1084200351 11:67553144-67553166 ATGATCCATAAGAGGAAAAATGG + Intergenic
1085776633 11:79372408-79372430 CTGTTCCTTTAGAAGAACCAGGG + Intronic
1086035172 11:82405834-82405856 ATGTTTCATATAAAGAATTAAGG - Intergenic
1086148675 11:83583670-83583692 ATCGTCCAGAAGAAGAACTGAGG - Intronic
1086869975 11:92026062-92026084 ATTTTCCATAAAAGGAACCAGGG + Intergenic
1087458452 11:98416918-98416940 ATATTTTTTAAGAAGAACTATGG + Intergenic
1090913584 11:131142934-131142956 ATTTTGCATAAGAAGCTCTAGGG + Intergenic
1092959443 12:13582062-13582084 ATGTTCCAAAAGGAGAAATAAGG + Intronic
1094139243 12:27163584-27163606 ATGTTCCACAAGCAAAACCAAGG + Intergenic
1095350440 12:41204359-41204381 GAGTTCCTTAAGAAGAACTAGGG + Intronic
1095392961 12:41730388-41730410 ATGTTCCCTAAATAGAACTCAGG + Intergenic
1095802510 12:46283183-46283205 ATGTTCCATAAGAAAAGAGATGG + Intergenic
1096420887 12:51456599-51456621 ATGTTACAGATGAAGAACTGAGG + Intronic
1097378943 12:58872260-58872282 ATTTTCCATAAAAAGAAATCTGG + Exonic
1098385021 12:69909486-69909508 ATGTTCCAAAAGAAAATTTAGGG + Intronic
1099451152 12:82808246-82808268 ATGTTTCAGAAAAAGAAATATGG + Intronic
1101812441 12:108119707-108119729 ATCTTGCATCTGAAGAACTAGGG + Intergenic
1103139457 12:118535936-118535958 ATGTTGCAGATGAAGAACTGAGG + Intergenic
1104297108 12:127526422-127526444 ATGTCACATGAGAAGACCTAAGG - Intergenic
1104938973 12:132386076-132386098 ATGTCCCACAAGGAGAACAAAGG + Intergenic
1107510267 13:41076609-41076631 ATGTTCTATCAGAAGACTTAAGG - Intronic
1107784793 13:43944032-43944054 ATGTTCCAGAAAAAGAAAGAAGG + Intergenic
1108826833 13:54422822-54422844 TTGTTCCATAAGGAGAAAAATGG + Intergenic
1108901353 13:55412235-55412257 ATTCTCCTTATGAAGAACTAAGG + Intergenic
1109421940 13:62124876-62124898 ATTTTCCAAAGGAAGAACAAAGG - Intergenic
1109689672 13:65869212-65869234 ATACTCCACAAGAAGATCTATGG - Intergenic
1111291154 13:86171569-86171591 ATTTTCCATAAGAATAAGCAAGG + Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114715742 14:24822074-24822096 TTTTTCCATAAGAAAACCTATGG - Intronic
1115759995 14:36570500-36570522 AACTTCCAGAAGAAGAACTATGG - Intergenic
1118731971 14:68674756-68674778 ATGTTCCATAAGTAGACCAGGGG + Intronic
1123843562 15:24272749-24272771 TTTTCCAATAAGAAGAACTAGGG - Intergenic
1123863280 15:24489431-24489453 TTTTCCAATAAGAAGAACTAGGG - Intergenic
1126810973 15:52403736-52403758 ATGTTTCATTAGAAGAAATGAGG + Intronic
1126949420 15:53863989-53864011 ATGTTCCAAATGAGGAACTCTGG - Intergenic
1127274197 15:57427809-57427831 ATGTTCCAAAAGTAGAAATTAGG - Intronic
1127562622 15:60155022-60155044 ATGTTCCATTAGAGTAACTATGG - Intergenic
1128372966 15:67053938-67053960 CTATTCCATATGAAGGACTAGGG + Intergenic
1128864221 15:71101579-71101601 TTGTTCCATAAGAAATGCTAAGG - Intronic
1130219093 15:82002675-82002697 ATCTTGAATAAGAAGAACAAAGG + Intergenic
1130297725 15:82659045-82659067 AGGGACCGTAAGAAGAACTAAGG + Intergenic
1136221093 16:28829431-28829453 AAGTTCAATGAGGAGAACTACGG + Exonic
1137325956 16:47437684-47437706 ATGTTCCATAATAAAATGTAAGG + Intronic
1137406163 16:48191132-48191154 ATGCACCATAAGGTGAACTATGG + Intronic
1138036663 16:53614070-53614092 ATGTTCCATAACAATATCAAGGG + Intronic
1139142781 16:64288193-64288215 ACTTTCCATCTGAAGAACTAGGG - Intergenic
1140414774 16:74766622-74766644 ATGTTCCAGAAGGAAAACTAAGG + Intronic
1140458382 16:75117739-75117761 ATGTTACATAATAAGAACCTTGG + Intergenic
1141204381 16:81922215-81922237 ATGTTTCATAAGAAGCAATGTGG - Intronic
1143982367 17:10880990-10881012 ATGTTACATAAAAAGGAATATGG - Intergenic
1149066710 17:52489201-52489223 ACCTTCCATCAGAAGAACCAGGG - Intergenic
1150880883 17:69026395-69026417 CTGTTCCTTAAGAAGAAATGGGG - Exonic
1153110724 18:1583238-1583260 AGTTTCCACAAGCAGAACTATGG - Intergenic
1159701718 18:71637382-71637404 ATCTTCAATAAAAGGAACTAGGG + Intergenic
1160045829 18:75386578-75386600 ATTTTCCTTAAGAAGAAATATGG - Intergenic
1164810553 19:31151574-31151596 AAATTCCATAAGGAGAACAAAGG + Intergenic
1165819261 19:38664227-38664249 AAGTTCCACAAGCAGCACTAAGG - Intronic
925849058 2:8062614-8062636 ATATTCCATAATAAGCATTATGG - Intergenic
926661817 2:15475119-15475141 ATGTTCCTTAAAGAAAACTATGG - Intronic
926809212 2:16741417-16741439 GTGTTCCATATGAAGTACTGGGG - Intergenic
927418875 2:22908539-22908561 ATTTGCCATAAAAAGAATTATGG - Intergenic
929895124 2:45953185-45953207 ATGTTCCATCAAAAGTACTGGGG - Intronic
930740095 2:54823453-54823475 TTGTTCCCTAAAAAAAACTATGG - Intronic
931049207 2:58391436-58391458 ATGTTCCATAGGAATAGATACGG - Intergenic
931284872 2:60823624-60823646 ATGTTCCTTGAGAAGCACAATGG + Intergenic
931859832 2:66343364-66343386 ACATTCCAAAAGAAGAGCTAAGG + Intergenic
932934229 2:76083070-76083092 ATGTAGCACAAGCAGAACTAGGG + Intergenic
937401162 2:121585073-121585095 ATTTTGCAGAAGAAAAACTATGG + Intronic
937683234 2:124667003-124667025 ATGTGCTTTAAGAAGAACGATGG + Intronic
938208905 2:129448138-129448160 ATGTTCAAAAAGATGAACTGAGG + Intergenic
940564176 2:155339524-155339546 ATGTTCATTAAGAAGTTCTATGG + Intergenic
941944319 2:171078039-171078061 AGGCTACATAAGAAGACCTAGGG - Intronic
941995458 2:171597575-171597597 ATGATCCAAAAGAAAAAATAGGG - Intergenic
942544157 2:177045153-177045175 ATGTTCCAGAAGAATAGCTTAGG - Intergenic
942775908 2:179582366-179582388 ATGTTCCATTAGGAAAATTATGG + Intronic
943965255 2:194324582-194324604 ATGTTCCAAAACAAGAATAAAGG + Intergenic
944620003 2:201504743-201504765 ACCTTCCATCTGAAGAACTAGGG + Intronic
945530190 2:210944095-210944117 ATGTTTGATAAGAAGAAGAAAGG + Intergenic
947412944 2:229861669-229861691 CTGTTCCAAAAGAGGACCTAAGG + Intronic
1172970718 20:38871270-38871292 ATGTTACATAAGAACATCTTTGG + Intronic
1173090492 20:39966197-39966219 ATGGTCAATAAGATTAACTAAGG - Intergenic
1174088070 20:48024374-48024396 ATACTCGATAAGAAGAAATAAGG + Intergenic
1175078930 20:56401654-56401676 ATGTCCAATAAGAAGCACTGAGG + Intronic
1175406500 20:58735147-58735169 ATGATCCATAAAAAGAAAAATGG + Intergenic
1175935740 20:62513187-62513209 ATGTTCCAGAAGAAGGTGTAGGG + Intergenic
1177054314 21:16280969-16280991 GTGTTACATTAGAAAAACTATGG + Intergenic
1181682297 22:24503884-24503906 ACCTTCCATGAGAAGAACCAGGG + Intronic
1182257148 22:29047641-29047663 AGGTTCCATGAGAAGATCCAGGG + Intronic
1184721554 22:46317386-46317408 AAGTACCATGAGAAGAAATAAGG - Intronic
951851597 3:27147284-27147306 ATGTTCCATCAGAAGAGAGAGGG + Intronic
952467833 3:33609683-33609705 ATATCTCATAAGCAGAACTAAGG - Intronic
953097733 3:39795198-39795220 ACCTTCCATCTGAAGAACTAGGG - Intergenic
953288253 3:41634344-41634366 ACCTTCCAGATGAAGAACTAGGG - Intronic
955066792 3:55540391-55540413 ATGTTCCAGACTGAGAACTAGGG + Intronic
955837709 3:63075775-63075797 ATTTTCAAAAAGAATAACTAAGG + Intergenic
958221635 3:90692262-90692284 AAGTTTCATAAGAAGAAATCCGG + Intergenic
960521673 3:118662334-118662356 ATTTTCCATCTGAAGAAATAGGG - Intergenic
960836829 3:121915455-121915477 CTGGCCCAAAAGAAGAACTATGG + Intronic
963342139 3:144049174-144049196 ATATTCCTTTAGAAGAACAAAGG + Intergenic
964689747 3:159437153-159437175 ATGTCTCAAAAGAAGAACAAGGG - Intronic
964812165 3:160677387-160677409 AAGTCCCAAAAGAAGAACTTGGG - Exonic
965406845 3:168280179-168280201 ATATTTTATAAGAAAAACTAAGG + Intergenic
967767806 3:193300939-193300961 ATATTCCAAAAGAAGAAACAGGG + Intronic
968141885 3:196264943-196264965 CTTTGCCATAAGCAGAACTATGG + Intronic
971571430 4:28216288-28216310 ATGTTCCATTAGCAGAATCAAGG + Intergenic
972554327 4:40166048-40166070 GTGTTCTATGAGAAGAACCAAGG - Intergenic
974148219 4:57972421-57972443 AAGTCCCAGAAGAAGAAATATGG - Intergenic
974638977 4:64605060-64605082 AAGCTCCATTAGAAAAACTAAGG - Intergenic
975656049 4:76642190-76642212 ATGATCCATTAGAAGAGATAGGG - Intronic
976365077 4:84224069-84224091 ATTTTACATAGGAAGAACAAGGG - Intergenic
976633518 4:87264413-87264435 ATGTTCAGTATGAAGAAGTAAGG - Intergenic
976875111 4:89844377-89844399 GTGTTGCTTAAGAAGAAATATGG - Intergenic
978063908 4:104372354-104372376 ATATTGCATAAGAAGAGATAAGG - Intergenic
979594077 4:122513890-122513912 TTGTTCCAGAAGGAGAACTAAGG + Intergenic
981845277 4:149160788-149160810 ATGGTCCTTAACATGAACTAAGG + Intergenic
983861595 4:172713908-172713930 CTGTTCCACAAGAAAAACTGAGG + Intronic
984151525 4:176138910-176138932 GTGTTCCACAAAAAGAATTATGG + Intronic
984282259 4:177684989-177685011 AGGTTCCATATAAAGAACTGTGG + Intergenic
986865916 5:11986894-11986916 ATTTTCAAAAAGAAGAAATAAGG + Intergenic
987257936 5:16176258-16176280 AAGTTCCATGAGAAGAGCTATGG - Intronic
988233895 5:28514127-28514149 AATTTCCATATGAAGGACTATGG + Intergenic
990667229 5:58086815-58086837 AGGTTCCATGAGAATAAGTATGG + Intergenic
992987884 5:82252045-82252067 ATGTTCCACGAGTAGAACCAGGG - Intronic
995433977 5:112114969-112114991 ATGTTATATAAGAAGAAGAATGG + Intergenic
995723233 5:115158627-115158649 ATGTACCAAAAGAAGCATTAAGG - Intronic
996342263 5:122451781-122451803 ATTTTCCAAAAGAAGAGCAAGGG - Intronic
996521678 5:124434456-124434478 ATCTTGAATTAGAAGAACTAAGG + Intergenic
996591544 5:125153502-125153524 CTTTTCCTTAAGAAGAATTATGG - Intergenic
996996327 5:129700824-129700846 AAGTTCCAAGAGAAGAAATATGG + Intronic
998949683 5:147380515-147380537 ATTTTCCATCAGAAGAAATTTGG + Intronic
999354851 5:150916569-150916591 ATGTTTCATAAGCAGAAGTTTGG - Intergenic
1000987885 5:167880806-167880828 ATGGTCCTTTATAAGAACTAAGG - Intronic
1004727767 6:18327317-18327339 ACCTTCCATCTGAAGAACTAGGG - Intergenic
1004925712 6:20413293-20413315 ATGTTTCATCAGAAGATCTTAGG - Intronic
1005367450 6:25093328-25093350 ATGTTCCAAAAGAAAAACTTAGG + Intergenic
1005595285 6:27373311-27373333 ATTTTCTATAAGGACAACTATGG + Intergenic
1007888251 6:45257241-45257263 TTTTACCATAAGAAAAACTAAGG + Intronic
1008343181 6:50392156-50392178 ATCTAACATAAGAAAAACTAGGG + Intergenic
1008897363 6:56571848-56571870 ATGTTGCATAAGAAAAACGATGG - Intronic
1009323366 6:62318489-62318511 CTGTTCCATACGAAGTACCAAGG - Intergenic
1012122779 6:95387955-95387977 ATATTTAATAAGATGAACTATGG - Intergenic
1013334604 6:109142717-109142739 ATGTTCCATAAGAATTCCTGAGG + Intronic
1014259618 6:119201400-119201422 ATGTTCAAGAAGAAGAAGAATGG - Intronic
1015327131 6:131935812-131935834 ATGTCCAATAAAAGGAACTAGGG - Intergenic
1015371048 6:132453368-132453390 ATGATCCATAAAAAGAAAAATGG + Exonic
1020506113 7:8990600-8990622 ATGGTCCATAAAAAGAAAGATGG + Intergenic
1021514456 7:21468088-21468110 CTTTTCCAAAAGAAGAAATAAGG + Intronic
1021780938 7:24105165-24105187 ATGTTCCATAACATGAAAAATGG - Intergenic
1022115993 7:27261089-27261111 ATGTGACATAAGATGAAATAAGG - Intergenic
1029499152 7:100917185-100917207 AACTTCCATCTGAAGAACTAGGG + Intergenic
1030241003 7:107324786-107324808 ATTTTTCATATGAAGAACAAAGG - Intronic
1031710346 7:125037140-125037162 ATTTGCTATAAGAAAAACTATGG - Intergenic
1032512526 7:132483104-132483126 AAGTTCCCTAAGAACAAGTATGG + Intronic
1033790393 7:144786184-144786206 ATTTGCCAAAGGAAGAACTAAGG + Intronic
1036030752 8:4969249-4969271 ATGTTCTATAAGAATTACTTAGG + Intronic
1039851295 8:41367784-41367806 ATGTCACATAAGTACAACTATGG + Intergenic
1043669384 8:82863000-82863022 ACCTTCCATCTGAAGAACTAGGG + Intergenic
1044167959 8:89012073-89012095 ATGTTCTAAAACAAGAAGTACGG - Intergenic
1045448437 8:102292537-102292559 ATGTTCCAGAACAAGATCAAGGG + Intronic
1047476488 8:125236955-125236977 ATGTACCTTAAGTAGAACAAAGG + Intronic
1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG + Intergenic
1048651177 8:136480032-136480054 GTGTTCCATGTGAAGAATTAGGG - Intergenic
1050010715 9:1183184-1183206 AAGTTGCATATGAAGTACTAAGG + Intergenic
1051236839 9:15009638-15009660 ATGTTCCTTATGAAGAACATTGG - Intergenic
1051366138 9:16322842-16322864 ATAATACATAAGAAGAACTTAGG + Intergenic
1051973634 9:22922087-22922109 ACCTTCCATTAGAACAACTAGGG - Intergenic
1056280271 9:85035084-85035106 ACCTTCCATCTGAAGAACTAGGG + Intergenic
1058527898 9:105878526-105878548 ATTTTCCAGAAGAAGAATTGAGG + Intergenic
1059907619 9:119005945-119005967 ATGTTGCATAAAAACAGCTATGG + Intergenic
1185745304 X:2567825-2567847 ATGTTCAAAAAAAAGAACCAGGG + Intergenic
1186566623 X:10669918-10669940 CTGTTCCAAATGAAGAAATATGG + Intronic
1187092554 X:16112259-16112281 ACATTTCATCAGAAGAACTATGG - Intergenic
1187105472 X:16237113-16237135 ATCTTCCATAAAAGGAATTATGG + Intergenic
1187895801 X:23978334-23978356 GTGTTCCATAAGGTGAACTGTGG + Intergenic
1187954180 X:24499615-24499637 ATGTTCCATAAGAAGAACTAGGG + Intronic
1189091371 X:38086184-38086206 ATGTTCCATGAGAAGGGCCAGGG + Intronic
1190786602 X:53656714-53656736 ATGTTGTATAAGAACAACAATGG + Intronic
1194994690 X:100578918-100578940 ATGTACCAAAAAAAGAACTCAGG + Intergenic
1196039838 X:111190356-111190378 ATGTTACATATGATGAACTGAGG - Intronic
1197991384 X:132321758-132321780 ATGATTCATAAGCAGAACTCAGG + Intergenic
1199970464 X:152856529-152856551 ATTTCCCATAAAAAGAACTAGGG + Intronic