ID: 1187955194

View in Genome Browser
Species Human (GRCh38)
Location X:24510852-24510874
Sequence CAACCTAGAAGGAAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187955186_1187955194 19 Left 1187955186 X:24510810-24510832 CCTTACATCAGTTACTTTTTCTA 0: 1
1: 0
2: 0
3: 26
4: 302
Right 1187955194 X:24510852-24510874 CAACCTAGAAGGAAACCTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1187955192_1187955194 -5 Left 1187955192 X:24510834-24510856 CCTGGCAAATGGGCTAGGCAACC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1187955194 X:24510852-24510874 CAACCTAGAAGGAAACCTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1187955191_1187955194 -4 Left 1187955191 X:24510833-24510855 CCCTGGCAAATGGGCTAGGCAAC 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1187955194 X:24510852-24510874 CAACCTAGAAGGAAACCTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187955194 Original CRISPR CAACCTAGAAGGAAACCTGC AGG Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900665118 1:3809978-3810000 CCACCTAGAAGGAATGCTGAGGG + Intergenic
902289622 1:15427657-15427679 CAGCCTAGGAGGAAGCCTGCGGG + Intronic
911579006 1:99613500-99613522 AAACCTAGAAGGAGAGCTGTGGG - Intergenic
911606127 1:99907464-99907486 CTACCTAGAAGAGAACTTGCTGG + Intronic
912635325 1:111286516-111286538 CAACCCATAAAGAAACCTGCTGG - Intergenic
916371670 1:164103257-164103279 CAGTCTAGAAGAAAACCTGAGGG - Intergenic
918357934 1:183723802-183723824 CAACCTAGAGAGACACCAGCTGG + Intronic
923049420 1:230380422-230380444 GCACCTGGAAGGAACCCTGCAGG - Intronic
923285902 1:232494968-232494990 CAAACTTGAAGGAAACCTATAGG + Intronic
923625107 1:235607246-235607268 GAACATAGAAAGAAACCTTCAGG - Intronic
923813892 1:237352561-237352583 CACACTAAAAGAAAACCTGCTGG - Intronic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1069563557 10:69448751-69448773 CAACTGGGAAGGAAACCTGATGG + Intergenic
1069891785 10:71656684-71656706 CAACCTGGAAGGAAGCCAGCTGG + Intronic
1070604555 10:77889613-77889635 CAGCCTAGCAGGTGACCTGCTGG - Intronic
1070761773 10:79028502-79028524 CAAGCTAGAAGGAAACCCCCAGG + Intergenic
1072509309 10:96102712-96102734 CAACCATGAAACAAACCTGCAGG + Intergenic
1075941594 10:126394798-126394820 CTCCCTAGGAAGAAACCTGCTGG - Intergenic
1077521352 11:3037283-3037305 CAAACTAGAAAGAAACATGCTGG + Intronic
1079665750 11:23103451-23103473 CAACCTTGATGGAAAAATGCAGG - Intergenic
1079978571 11:27124244-27124266 CATCCTAGAAGGACAAGTGCAGG - Intronic
1083340990 11:61958265-61958287 CAACATAGAAGAAGAACTGCAGG - Exonic
1085905940 11:80762785-80762807 CAATCTAGAATGATACTTGCTGG - Intergenic
1085980450 11:81718174-81718196 CAACCTAGTAAGACACCAGCTGG + Intergenic
1087181959 11:95150513-95150535 CCATCTACAAGGAAACCTGGAGG + Intergenic
1088751250 11:112844033-112844055 CAACCAAGAAGGAAAAGTGCAGG + Intergenic
1089735258 11:120546424-120546446 CCACCTAGAAGGACACAGGCAGG - Intronic
1091288319 11:134421641-134421663 CAAGTTAGAAGGAAGCCTGCAGG + Intergenic
1096491196 12:52014082-52014104 CAAGCTAGCAGGAAACTAGCAGG - Intronic
1097555369 12:61130042-61130064 CAACCAAAAAAGAAAACTGCAGG - Intergenic
1097826372 12:64178680-64178702 CTATCTGGAAGGAAACCTACAGG + Intergenic
1099929431 12:89056993-89057015 CCACATATAAGGAAAACTGCTGG - Intergenic
1101239382 12:102823554-102823576 CAACCAAGAAGAAAACTTGGTGG + Intergenic
1106215745 13:27697389-27697411 CAACCAAAAAAGAAAACTGCAGG - Intergenic
1107098729 13:36564661-36564683 CTACCTACAAAGAAAACTGCAGG + Intergenic
1108612921 13:52101713-52101735 CTAACGAGAAGGAACCCTGCAGG + Intronic
1112303920 13:98256056-98256078 CCTCCTAGAAGCGAACCTGCTGG - Intronic
1112811719 13:103225907-103225929 CAGCCTAGGAGGAAGCCTCCTGG + Intergenic
1113878041 13:113606885-113606907 CAACCTAAAAGGAAACCACACGG - Intronic
1114719553 14:24866191-24866213 CAAGCAAGAAGGAATCCTGCTGG + Intronic
1118057643 14:62098115-62098137 CAACATAGAAAGAAAACTGCAGG + Intronic
1118108361 14:62687285-62687307 TAACCTAGAAGAAAACCTTCAGG + Intergenic
1122626370 14:103087353-103087375 CCACCTAGAAGGGAAGCTGCTGG - Intergenic
1124802585 15:32848526-32848548 CAACTTAAAAGGAAATCTGAAGG - Intronic
1126099021 15:45108541-45108563 CAACCCAGAAGCCACCCTGCAGG + Intronic
1126397435 15:48233903-48233925 CAACCTAGAAGAAAAACAGAAGG - Intronic
1127628419 15:60802857-60802879 GAACCCAGAATGAAACCTCCAGG - Intronic
1127760138 15:62131643-62131665 CAACCAGCAAGGAAAGCTGCGGG - Intergenic
1128808964 15:70556128-70556150 CAACCTAGAAGGAAATCACTGGG + Intergenic
1136845450 16:33572701-33572723 TAAGCTAGTAGGAAACCTCCAGG - Intergenic
1203107158 16_KI270728v1_random:1421354-1421376 TAAGCTAGTAGGAAACCTCCAGG - Intergenic
1144178130 17:12728208-12728230 CAAGCTAGAAGTAAGCCTGTAGG - Intronic
1147231113 17:39018673-39018695 AAAGCTTGAAGGAAACCTGCAGG + Intergenic
1147304551 17:39554245-39554267 GAACCTGGAAGGATAACTGCTGG + Intronic
1148995106 17:51702680-51702702 CACCCTGGAAGGAAACCAGAGGG + Intronic
1152401653 17:80070165-80070187 CAGGCTAGAAGGAGGCCTGCTGG - Intronic
1153245233 18:3066768-3066790 CAACCTAGCAGCAAAACAGCAGG + Intergenic
1153680393 18:7495149-7495171 AATCCTAGAAGAAAACCTGGAGG - Intergenic
1153992345 18:10411635-10411657 CCACCTAGAAGGCAAACTGCAGG + Intergenic
1154081183 18:11258760-11258782 CAACCTAGAAAAGAACCTGAAGG + Intergenic
1154087469 18:11321544-11321566 CAACCTAGAAAGAATCCTCTAGG - Intergenic
1156177967 18:34569736-34569758 CAACCAAGAAGGAATTCAGCAGG - Intronic
1157622676 18:49025340-49025362 GAACCTAAAAGGAAATCTGGAGG + Intergenic
1160123139 18:76147974-76147996 CAACCTAGATGGAAAATTACTGG - Intergenic
1161118461 19:2512389-2512411 CAAGCTAGAAAGAAACCCACAGG + Exonic
1161921474 19:7269514-7269536 GAACCAAGCAGGAACCCTGCAGG + Intronic
1162243446 19:9378282-9378304 CAGCCAGGAAGGAAACCTACAGG + Exonic
1164319824 19:24133901-24133923 CAACTAAGAAAGAAAACTGCAGG - Intergenic
1164337707 19:24346741-24346763 AAATCTAGAAAGAAACCTTCTGG + Intergenic
1165302884 19:34983217-34983239 CAAACTAAAAGGAAAACTTCTGG - Intergenic
927530044 2:23788511-23788533 CCACCACGAAGGAAACATGCTGG - Exonic
930415331 2:51083867-51083889 TAACCTAGAAGAAAAACTACTGG - Intergenic
931678545 2:64722822-64722844 AAACCTAGGAGTAAAACTGCTGG + Intronic
933581108 2:84128071-84128093 CAGCCTGGAAGGGGACCTGCTGG - Intergenic
935323479 2:101911468-101911490 TACTCTAGAAAGAAACCTGCAGG + Intergenic
936109161 2:109650909-109650931 CAACCTAGCAGGAAGCTGGCGGG + Intergenic
936523611 2:113227890-113227912 CAACCTAGAAGGAGATGTGGCGG + Intronic
936659861 2:114530636-114530658 CAACTTGGAAGGAACCCTGGAGG - Intronic
937609018 2:123838360-123838382 CAACATCAAAGGAAAACTGCAGG + Intergenic
937662577 2:124447174-124447196 AAAATGAGAAGGAAACCTGCTGG - Intronic
938809721 2:134842230-134842252 CAACCTAGGATGAGAACTGCGGG + Intronic
939840430 2:147181550-147181572 GAACTTAGAAGGAAACATACAGG - Intergenic
940800353 2:158126206-158126228 CATCCAGGAGGGAAACCTGCAGG - Intronic
941085208 2:161109579-161109601 CAAACTCTAAGGAAACCTGCTGG + Intergenic
943152775 2:184135242-184135264 CAACAAAGAAGGAAAACTTCAGG - Intergenic
944856890 2:203776696-203776718 CAACCTGGAAGTAAATCTCCTGG + Intergenic
947008089 2:225535559-225535581 TAGCCTATAAGGAAAGCTGCAGG - Intronic
1169773998 20:9231780-9231802 AAACCTAGAAGTAAAATTGCTGG - Intronic
1170010764 20:11720568-11720590 CAAAGTAGAAAGAAAACTGCTGG + Intergenic
1172259273 20:33548200-33548222 CAAAATAAAAGGAAACCTACAGG - Intronic
1173666429 20:44766522-44766544 CAACCAAAAAGGAGACCTGTAGG + Intronic
1178991212 21:37358269-37358291 CAAGCTAGAAGGAAATGTGGAGG + Intergenic
1179409803 21:41153901-41153923 CTACCTGGAAGGCTACCTGCTGG - Intergenic
1180098310 21:45571971-45571993 CTCCCTGGAAGGAAAGCTGCAGG - Intergenic
1183439183 22:37813579-37813601 CGACCTAGAAGCCAAGCTGCAGG + Exonic
949798561 3:7878146-7878168 CAGTCTAGAAGGAAGGCTGCAGG - Intergenic
950831057 3:15876876-15876898 AATCCTAGAAGGAAGACTGCTGG - Intergenic
952550752 3:34473695-34473717 AAACCTAGAAGGACAATTGCTGG - Intergenic
953349629 3:42205701-42205723 GATACTAGAATGAAACCTGCTGG - Intronic
954758457 3:52856301-52856323 GAAACTAGAATGAATCCTGCAGG + Intronic
955485976 3:59435003-59435025 AAACCTAGAAGGGAAATTGCTGG - Intergenic
957086390 3:75682809-75682831 CAACAAAGAAAGAAACCTTCAGG - Intergenic
957163263 3:76637210-76637232 CAACCTAAGAGGCAACCAGCAGG + Intronic
958700997 3:97589370-97589392 CAAGCCAGAAGGAAGCATGCAGG + Intronic
959679960 3:109083701-109083723 CAACCAAAAAGGAAAACTACAGG + Intronic
960175236 3:114509963-114509985 CAACCTAGTGGGAACCCTTCAGG + Intronic
966009909 3:175062201-175062223 TAATCTTGAAGGAAAACTGCAGG + Intronic
967319301 3:188179585-188179607 TAAACTAGAAGGAATGCTGCTGG - Intronic
971046315 4:22809015-22809037 CAACCGAGAAAGAGCCCTGCTGG + Intergenic
971678070 4:29660271-29660293 CAACATGGAAGAAAATCTGCTGG - Intergenic
972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG + Intergenic
973270474 4:48257400-48257422 CAACCTAGAAAGAAATGTGAAGG - Intronic
974986241 4:69029274-69029296 CAACTGTGAAGGAAACCTTCTGG - Intronic
979372786 4:119909038-119909060 GAACATAGGCGGAAACCTGCTGG - Intergenic
979426646 4:120575104-120575126 CAACCAAAAAGGAAAACTACAGG + Intergenic
981802675 4:148676820-148676842 CAACCTTAATGGAAACCTGTGGG - Intergenic
983286969 4:165752117-165752139 GAACCTAAAAGGAAGCTTGCTGG + Intergenic
983868450 4:172796740-172796762 CAATATAGAAGGAAATATGCAGG - Intronic
984974491 4:185218429-185218451 CAACATACATGCAAACCTGCTGG - Intronic
985121087 4:186642845-186642867 CAACCTAGGAAGCAATCTGCTGG + Intronic
985781542 5:1874276-1874298 CCATCTACCAGGAAACCTGCAGG + Intergenic
987269994 5:16297406-16297428 CAACATAGAAAGAAAACTTCAGG + Intergenic
988311666 5:29566817-29566839 TAACGTAGAAAGAAACCTCCAGG + Intergenic
989330976 5:40257887-40257909 AAACCTAGCAGGAAGCCAGCTGG - Intergenic
990908300 5:60826765-60826787 CCACCCAGAAGGAAACCCCCTGG - Intronic
994533927 5:101003932-101003954 CAACCAAGAAAGAAAACTACAGG + Intergenic
996210743 5:120806311-120806333 CAACCTATCATGAAAACTGCTGG + Intergenic
1000024200 5:157344736-157344758 CAACCCAAAATGAAACCTACGGG - Intronic
1003779829 6:9411870-9411892 CATCACACAAGGAAACCTGCTGG + Intergenic
1005297768 6:24443430-24443452 CCACCCAGAAGGAAAGCTGAGGG - Intronic
1005989137 6:30892403-30892425 CAACCTAGGGGGCAACCTGGGGG + Exonic
1009039427 6:58158802-58158824 CAACCTAGTAAGACACCAGCTGG - Intergenic
1009428790 6:63543345-63543367 GTGCCAAGAAGGAAACCTGCAGG - Intronic
1009805188 6:68593193-68593215 CAACCAAAAAGGAAAACTTCAGG - Intergenic
1010253494 6:73732698-73732720 CAACCCAGAACTAACCCTGCTGG + Intronic
1013458680 6:110356052-110356074 GAATCTAAAAGGAAAACTGCAGG + Intronic
1014458932 6:121671787-121671809 AAAACTAGAAGGAAATGTGCTGG + Intergenic
1017188607 6:151627669-151627691 CTACCTAGTAGGAAAACTGAGGG + Intergenic
1019018160 6:168895684-168895706 CAACTAAGAAGGAAACAGGCTGG + Intergenic
1020724905 7:11800129-11800151 CAGCCTAGAGGGAAGACTGCAGG + Intronic
1023803329 7:43853617-43853639 CTACCTAGAAGGAATTCTGCCGG + Intergenic
1024086646 7:45897497-45897519 CAAGCAAGAAGGAATTCTGCTGG - Intergenic
1025813706 7:64890855-64890877 CAACGGTGAAGGAAGCCTGCTGG - Intronic
1028909357 7:96190497-96190519 CAACCTCTAAGGAAGCCTTCAGG - Intronic
1031437967 7:121756269-121756291 GAGCCTAGAAGGAACGCTGCGGG + Intergenic
1035755921 8:2033027-2033049 CAATCTAGAAGGAAACATGATGG + Intergenic
1037454202 8:19047464-19047486 CATCCTAGAAAGAAGGCTGCAGG - Intronic
1038652867 8:29421535-29421557 CACCCTAGCAGGAAACGTGAGGG - Intergenic
1039111899 8:34050173-34050195 CAGCTATGAAGGAAACCTGCTGG + Intergenic
1039217767 8:35291981-35292003 AAACCTAGAAGAAAACCAGCGGG - Intronic
1040976796 8:53202365-53202387 CTACCTAGGAGTAAAACTGCTGG - Intergenic
1042086259 8:65112521-65112543 CAGCCCAGAAGGAAATCTGTGGG - Intergenic
1042202477 8:66292482-66292504 CAAGCTATAATTAAACCTGCAGG - Intergenic
1044298650 8:90557452-90557474 CAACCTAGAGGTCAACCTACTGG - Intergenic
1045553596 8:103194435-103194457 CAACCTAGAAGCAAACCGTGAGG + Intronic
1045600366 8:103708082-103708104 CAACCCAGCATGAAACCTTCTGG - Intronic
1050511520 9:6401115-6401137 AAACCAAGTTGGAAACCTGCTGG - Intergenic
1051383886 9:16486080-16486102 CAACAAAGCAGGAAGCCTGCTGG - Intronic
1051857880 9:21589833-21589855 CAGCCTAGAAGGGAGCCTGTGGG + Intergenic
1052938682 9:34114688-34114710 CATCCTAGAATGTAAACTGCAGG - Intronic
1055249092 9:74280913-74280935 GAAACTAGAATTAAACCTGCAGG + Intergenic
1056209477 9:84352143-84352165 CCACATAGAGGGAAATCTGCAGG - Intergenic
1058921971 9:109625411-109625433 AAAACTAGAATGAAACCTGTGGG - Intergenic
1061200507 9:129135817-129135839 GAACCTAGGAGATAACCTGCTGG + Intronic
1061474712 9:130856872-130856894 CAACCTAAAAGTCAACCAGCAGG - Intronic
1186106296 X:6210554-6210576 CTACCCAGAAGGAATGCTGCTGG - Intronic
1186894569 X:13992947-13992969 CAACCTATCAGAAAGCCTGCTGG - Intergenic
1187955194 X:24510852-24510874 CAACCTAGAAGGAAACCTGCAGG + Intronic
1191891324 X:65944987-65945009 CAACCAAAAAGGAAAACTTCAGG - Intergenic
1194122467 X:89977274-89977296 CTAAAGAGAAGGAAACCTGCAGG + Intergenic
1194520771 X:94916643-94916665 TAATCTACAAGGAAACGTGCAGG + Intergenic
1195105663 X:101599852-101599874 CCACCTGGAAGGCAAGCTGCGGG - Intergenic
1195107220 X:101613915-101613937 CCACCTGGAAGGCAAGCTGCGGG + Intergenic
1195786698 X:108532128-108532150 CAACCAAAAAAGAAAACTGCTGG + Intronic
1196059504 X:111392112-111392134 CAATATAGAAGGAAACATGAAGG - Intronic
1200763445 Y:7060973-7060995 TAACCTGTTAGGAAACCTGCTGG + Intronic
1201491209 Y:14543544-14543566 CTACCCAGAAGGAATGCTGCTGG + Intronic