ID: 1187956690

View in Genome Browser
Species Human (GRCh38)
Location X:24525520-24525542
Sequence TTGGGTCATGAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 503}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187956684_1187956690 16 Left 1187956684 X:24525481-24525503 CCTGAGAGAGTTCATGTAGTTTC 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 62
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187956690 Original CRISPR TTGGGTCATGAGGAGGAGGA AGG Intronic
900156709 1:1206110-1206132 TGGGGTCTGGAGGTGGAGGACGG - Intronic
900192733 1:1358349-1358371 TTGGGCCAGGAGGAGTGGGAAGG - Intronic
901469502 1:9446462-9446484 TTTGGTAATGAGGAGGAGGGTGG + Intergenic
902913017 1:19615053-19615075 GTGGGTCCAGAGAAGGAGGATGG - Intronic
903017691 1:20371932-20371954 TTTGATAATGAGGAAGAGGAGGG + Intergenic
903320345 1:22539264-22539286 TTGGTGGATGGGGAGGAGGATGG - Intergenic
903593047 1:24471686-24471708 ATGGTTCATGAGGAAGAGAAGGG + Intronic
904431782 1:30469009-30469031 GAGGGGCATGAGGGGGAGGAAGG + Intergenic
904617012 1:31755375-31755397 ATGGGTCCTGAGGGGGAAGACGG + Intronic
904770581 1:32878961-32878983 CTGGGTCATGAGGAGCAGGCTGG + Intergenic
904932429 1:34099938-34099960 TTGGCTGATGAGAAGGTGGAAGG + Intronic
904941731 1:34168393-34168415 GGGGGCCAGGAGGAGGAGGATGG + Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905641858 1:39595488-39595510 TTGGGTGTTCAGGAGGAGAAGGG - Intergenic
906475790 1:46168563-46168585 TTGGGTTATGATAAGGAGGCTGG - Intronic
906530007 1:46518321-46518343 GTGGCTCATGAGAAGGAGGTGGG + Intergenic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
907282789 1:53361931-53361953 TGGGGCCATGGGGTGGAGGAAGG + Intergenic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
907481798 1:54750096-54750118 TTGGGTCATGAAGTTGAAGAAGG + Intergenic
907493790 1:54827953-54827975 TTGAGGCTTGAGGAGGATGAGGG + Intronic
907811131 1:57871122-57871144 ATTGGTGATGAGGAGGAGGAGGG - Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
911782037 1:101893092-101893114 TTGGTTTCTGAAGAGGAGGAAGG + Intronic
911936469 1:103981438-103981460 ATGGGGCATGGGGCGGAGGAGGG + Intergenic
912155508 1:106914070-106914092 GTGGGTGAAGAGGAGGAGAAAGG + Intergenic
912994442 1:114518830-114518852 GTGGGTGATGAGGAGGGGGAAGG - Intergenic
914960160 1:152197907-152197929 GAGGATCATGAAGAGGAGGAGGG - Intergenic
915270763 1:154751682-154751704 TGGGGTCATGGGGAGGAGTCAGG - Intronic
915475338 1:156149839-156149861 TTCGCACATGTGGAGGAGGAGGG - Intronic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
915555838 1:156660228-156660250 TTGCGTCCTGAGGAGGCGGGAGG + Intergenic
915929917 1:160053990-160054012 TTGGGGATTGAGGTGGAGGAAGG - Intronic
916294540 1:163203026-163203048 GTGGGCCCTGAGGTGGAGGAGGG + Intronic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917652694 1:177094743-177094765 TTGGGTAATGAGTAAGAGGCTGG + Intronic
918094467 1:181323167-181323189 TTGGTTCATGAGAAAGGGGAAGG - Intergenic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
921013318 1:211163255-211163277 ATGGATCATTAGGAGGAGGGTGG - Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922375437 1:224959271-224959293 TGGGGTAATGAGGAGGAGGGTGG - Intronic
923047583 1:230366990-230367012 GTGGGACCTGACGAGGAGGAAGG + Intronic
923400107 1:233608453-233608475 TAAGGTCAAGGGGAGGAGGAGGG - Intergenic
923515931 1:234698130-234698152 TTTGGTGATGAAGAGAAGGAGGG - Intergenic
1063494626 10:6495427-6495449 TTAGGTGAAGAGCAGGAGGAAGG - Intronic
1063540130 10:6924848-6924870 TTGGGTCATGGAGAGTAGGGAGG - Intergenic
1065489091 10:26264697-26264719 TAGGGTCGGGAGGAGGAGCAGGG + Intronic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066559256 10:36651363-36651385 TAGGGTGATGAAGAGGAGAAGGG - Intergenic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070572997 10:77655635-77655657 TTGGGTGTTGTGGAGGAGAAAGG - Intergenic
1070656241 10:78273507-78273529 TTGGGAGTTGATGAGGAGGAGGG - Intergenic
1070784184 10:79153671-79153693 ATGGGTCATGAGGAGGGAGAAGG - Intronic
1071257877 10:83889531-83889553 ATGGGTCAGGAAGAGGAGTAGGG - Intergenic
1071959881 10:90799736-90799758 TTGGGTCATAGGGTGGATGATGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072436058 10:95415648-95415670 GAGGGTCAGGAGGAGGAGCAGGG + Intronic
1073670780 10:105585391-105585413 GTGGGTCATGAGGGTGAAGAGGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074364046 10:112843990-112844012 TGGGGTGTTCAGGAGGAGGAAGG + Intergenic
1074398478 10:113120520-113120542 GTAGGACATTAGGAGGAGGAAGG + Intronic
1074891469 10:117739579-117739601 ATGGGGCATGAGGACGACGAAGG + Intergenic
1075317248 10:121462698-121462720 TTGGGAAATGAGAAGGAGAATGG + Intergenic
1075592947 10:123705700-123705722 TTAGGATATGAGGAGGAGGATGG - Intergenic
1075979457 10:126724301-126724323 TTGGGTCAAGCAAAGGAGGAGGG + Intergenic
1077014990 11:395478-395500 AGGGGTCATGGGGTGGAGGACGG + Intronic
1077230168 11:1455154-1455176 TTGGGTTAGGAGGAGCAGAAAGG + Intronic
1077545903 11:3169668-3169690 TGGGGGCCTGAGGAGGAGCAGGG + Intergenic
1077678058 11:4214890-4214912 GTGGGTGATGAGGAGGTGAAAGG + Intergenic
1078595453 11:12682519-12682541 TTGGGAAATGAGGGGTAGGAAGG + Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1078898857 11:15622810-15622832 TTTGGGCATGGGGAGGAGGGAGG - Intergenic
1079062926 11:17265322-17265344 TTGGGTAATGAAGAAGAAGATGG + Intronic
1080115963 11:28621864-28621886 TTGGGTGATGGGGAGGAGGAAGG - Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1083395826 11:62391191-62391213 GTGGGGCATGAGGAGGAGACAGG + Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1085057112 11:73411458-73411480 TTGGGTGATGGGGAGTAGGGGGG + Exonic
1085644978 11:78217025-78217047 TTGGGTCCAGTGGAGGAAGAAGG - Exonic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1086064029 11:82728353-82728375 TTGGGACATGAGGAGGATACAGG + Intergenic
1087139410 11:94750665-94750687 TCAGGGCTTGAGGAGGAGGATGG - Intronic
1087965756 11:104412617-104412639 TTAGGTCAGGAGGAGGCAGATGG + Intergenic
1088920433 11:114256969-114256991 CTGGGTCTTGAGGAGGAGAGGGG - Intergenic
1089167507 11:116488442-116488464 TTGTGACCTGAGGAGGAGGAGGG + Intergenic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1090096965 11:123751954-123751976 TTGGGTCATGACGGGAAGAAGGG - Intergenic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1091263199 11:134250205-134250227 GTACGTCATGAGGAGGAGGCAGG + Intronic
1091349420 11:134881140-134881162 TTGGATGCTGAGGATGAGGATGG + Intergenic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093902087 12:24647301-24647323 TTGGAACATGAGGAGGAGAGGGG + Intergenic
1094623154 12:32099455-32099477 TGGGGTAATGGGGTGGAGGATGG + Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096110570 12:49026844-49026866 TTCTGTCATGAGGAGGGTGACGG - Exonic
1096111989 12:49034348-49034370 TTGGGTCATATGGAGGAAGAGGG - Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096816870 12:54207386-54207408 TTGGGCCATGAGGAAGAGGCTGG + Intergenic
1097008598 12:55936618-55936640 GGGTGTAATGAGGAGGAGGAGGG - Intronic
1097182150 12:57177719-57177741 TGGGCACAGGAGGAGGAGGACGG + Intronic
1100281703 12:93124696-93124718 TTGGGTCATGAGGTTAAGGATGG - Intergenic
1102238065 12:111307113-111307135 GTGGGTCCTGGGGAGGAGGCAGG + Intronic
1102927466 12:116837158-116837180 TGATGTCAGGAGGAGGAGGAGGG - Intronic
1102970484 12:117162231-117162253 ATGGATCATGATGAGGACGAAGG + Intronic
1103024437 12:117562250-117562272 TGGGGACATGAGGAAGGGGAGGG + Intronic
1103266096 12:119631561-119631583 TTGGCCCATGAAGAGGAAGATGG + Intronic
1103917162 12:124381850-124381872 TTCGGCCATAAGGAGGGGGAGGG + Intronic
1104536254 12:129620819-129620841 TTGGGGGATGAGGAAGAGGAAGG + Intronic
1104705681 12:130945085-130945107 TGGGGTCAGGAGGATGAGGAGGG - Intergenic
1104842015 12:131829952-131829974 AAGGGTCTTGAGGAGGTGGAGGG - Intronic
1105592976 13:21811541-21811563 TCAGGGCAGGAGGAGGAGGAGGG + Intergenic
1106114690 13:26807062-26807084 TTGGGCCATGACAAGGAGGGAGG + Intergenic
1107035846 13:35901700-35901722 GTGGGGCCTGAGGAGAAGGATGG - Intronic
1107314019 13:39111717-39111739 TTGTGGCATGAGGTGGAGGTTGG + Intergenic
1107833189 13:44392495-44392517 TGGGGTCTTGGGGAGGATGATGG + Intronic
1108001171 13:45907028-45907050 TGGCTTGATGAGGAGGAGGAGGG + Intergenic
1108287800 13:48925905-48925927 TTGGGGCATGAGCAGCAGGAAGG + Intergenic
1108313116 13:49215083-49215105 GTGGGTCATGTGAATGAGGAAGG + Intergenic
1108712589 13:53048530-53048552 TTGGGTGAGGAGGATGGGGAGGG + Intronic
1109268595 13:60229154-60229176 TGGGATCTTGAGGAGGAGAAAGG - Intergenic
1109575355 13:64249648-64249670 TGGGGTCATAATTAGGAGGATGG + Intergenic
1109721114 13:66277502-66277524 TGAGGTCTTGAGGACGAGGATGG - Intergenic
1109747430 13:66645262-66645284 ATGGGTGATGGGGAGGAGGAAGG - Intronic
1109767843 13:66928286-66928308 TGGGGTCATGATGATGAAGATGG + Intronic
1111330871 13:86761131-86761153 TGGGGGAATGAGGAGGAGGCGGG + Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1113207954 13:107940390-107940412 TTGGATCATGAGCATAAGGAGGG - Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116527501 14:45924957-45924979 TTGGGTCATGAAGAGGCATATGG + Intergenic
1117541038 14:56746735-56746757 GTGGATGATGAGGAGGAGGGTGG + Intergenic
1118572514 14:67207712-67207734 TTGGGAAATTAGGAGGAGGGGGG + Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1121245467 14:92458512-92458534 GTGGGACATGAAGAGCAGGAGGG + Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121888503 14:97566963-97566985 TTATGTCATGGGCAGGAGGATGG + Intergenic
1122110875 14:99501171-99501193 GTAGGTCATGAGGAGGAAGAAGG + Exonic
1122325914 14:100880591-100880613 TTGGGTCAGGAGTGGCAGGAAGG + Intergenic
1122507081 14:102238570-102238592 AGGGGTAATGAGGAGGAGGGAGG - Intronic
1122645916 14:103193867-103193889 TTGGGTCTTGGGCAGGAGGAAGG + Intergenic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1126277128 15:46896492-46896514 TTGGGACATCAGGGAGAGGAAGG + Intergenic
1126315455 15:47364758-47364780 TTGGGGGATGGGGAGGAGGGTGG - Intronic
1127260696 15:57324303-57324325 GAGGGACATGAGGAGGGGGAGGG - Intergenic
1127310453 15:57747464-57747486 GTGGGGCCTGAGGAGGAGGAGGG - Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127810228 15:62559417-62559439 TTTGGCCATGAAGAGTAGGAAGG - Intronic
1127846647 15:62876630-62876652 TTGGGTCATGATGAAAAAGAGGG + Intergenic
1127959259 15:63878915-63878937 CTGGGTCAAGCGGAGGAGGCAGG + Intergenic
1128645692 15:69377304-69377326 TTTGATCCTGTGGAGGAGGACGG - Intronic
1128967935 15:72079201-72079223 TGGGGGCAGGAGGAGGAGCAAGG + Intronic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129156237 15:73719886-73719908 TTGCAACATGAGGAGCAGGAAGG - Intergenic
1129674247 15:77623691-77623713 TGGGGGTCTGAGGAGGAGGAGGG - Intronic
1129760628 15:78127380-78127402 CTGGGTCATGAGGAGTGGAAGGG + Intronic
1129845695 15:78766801-78766823 TTGGGTGATGAGGCGGGTGAAGG + Exonic
1129846251 15:78768928-78768950 TTGGGTGATGAGGCGGGTGAAGG + Intronic
1129929622 15:79399506-79399528 TTGGGTCTGGAGAAGTAGGATGG + Intronic
1130138418 15:81200966-81200988 TTGGAGGATGAGGAGAAGGAAGG - Intronic
1130255659 15:82324998-82325020 TTGGGTGATGAGGCGGGTGAAGG - Intergenic
1130256163 15:82327059-82327081 TTGGGTGATGAGGCGGGTGAAGG - Intergenic
1130598790 15:85262927-85262949 TTGGGTGATGAGGCGGGTGAAGG + Intergenic
1130599305 15:85264988-85265010 TTGGGTGATGAGGCGGGTGAAGG + Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1133598312 16:7314097-7314119 TTTGGACTTGGGGAGGAGGAAGG + Intronic
1133646028 16:7765519-7765541 TGGGGTCAGGAGGGAGAGGATGG + Intergenic
1134036640 16:11036273-11036295 GGGGGTGATGAGGTGGAGGATGG - Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135967396 16:27047488-27047510 GTGGTTCAAGAGGAGGGGGAAGG - Intergenic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137532438 16:49287906-49287928 TTGAGTCCAGGGGAGGAGGATGG - Intergenic
1137844568 16:51674602-51674624 TTGGGGGCTGAGGACGAGGAGGG - Intergenic
1138981973 16:62280743-62280765 TTAGGTGAGGAGGTGGAGGAGGG - Intergenic
1139580311 16:67869393-67869415 ATAGGTCTTGAGAAGGAGGAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140606982 16:76550914-76550936 TTGGGTAATGAAGAAGAGCAAGG + Intronic
1140952093 16:79828052-79828074 TTGGGTCATTAAGAGAAGCATGG + Intergenic
1141651712 16:85396439-85396461 TTGGGTGCTGGGGAGGTGGAAGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142121878 16:88390489-88390511 TTGGGTCAGGAGGAGCAGTGGGG - Intergenic
1142181905 16:88675328-88675350 CCGGGTCTTGAGGAGGAGTAGGG - Intergenic
1142310036 16:89306961-89306983 TTGGGACGTGGGGAGGGGGACGG + Intronic
1144003888 17:11082060-11082082 CTGGTTCATGAGGAGGAGGGTGG - Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144658541 17:17053352-17053374 TTGGGTCCTGATGAGGATGCAGG + Intronic
1145933521 17:28702050-28702072 TTGGGGCAGGAGGGAGAGGAGGG + Exonic
1146553001 17:33798206-33798228 TTGGGGCAGGAGGAGGAAGTAGG + Intronic
1146639445 17:34528981-34529003 TTGAGTGATGAGGATGAGGATGG + Intergenic
1146660665 17:34663315-34663337 ATGGGGCAGGAGGAGGAGGCTGG + Intergenic
1146789808 17:35744972-35744994 GTAGGTGAGGAGGAGGAGGAAGG - Exonic
1147970757 17:44218452-44218474 GGGGGTCACGAGGAAGAGGAGGG - Intronic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1151187253 17:72373439-72373461 TTGGGGTATGGGGAGGATGATGG + Intergenic
1151361709 17:73593100-73593122 TGGGGTGGGGAGGAGGAGGAGGG - Intronic
1151389313 17:73775073-73775095 TGGGGAAGTGAGGAGGAGGAAGG + Intergenic
1151403897 17:73874510-73874532 TTGGGTCATGCTCAGCAGGAGGG - Intergenic
1151618757 17:75232063-75232085 GTGGCTCGTGAGGAGGAGGATGG - Intronic
1152091656 17:78250791-78250813 GTGGGTCAGGAAGAGGATGAGGG + Intergenic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152657275 17:81525862-81525884 TGGGGTCCTGAGGTGGAGGCAGG + Intergenic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1153800101 18:8661159-8661181 TGAGGTCCTGTGGAGGAGGAGGG + Intergenic
1156793857 18:41015624-41015646 TTGGGTCCTGTGGAGTGGGAGGG - Intergenic
1157410685 18:47460484-47460506 CTGGGTCTTGAGGACCAGGAGGG - Intergenic
1157563589 18:48664763-48664785 GTGGGTCATCAGGAGCAGGTGGG - Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157910589 18:51614287-51614309 ATGGGTCAACAGGAGTAGGAAGG - Intergenic
1158400131 18:57114493-57114515 GTGAGTTATGAGGAGGAGTAGGG - Intergenic
1159009274 18:63042928-63042950 TGGGAGCATGGGGAGGAGGATGG + Intergenic
1160020532 18:75177215-75177237 TGAGGTCATGAGGATGAGGCGGG + Intergenic
1160450118 18:78957287-78957309 TTGGATCATGAGGAGGTTTAGGG + Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1161166805 19:2792046-2792068 TGGGGACAGGAGGAGGAGGAAGG - Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162391023 19:10390300-10390322 GTGGGGAATGAGGAGGAGGCTGG + Intergenic
1162651605 19:12092706-12092728 CTGGGCCATGAGGAGGATCATGG + Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163827814 19:19533447-19533469 AGGGGGCAGGAGGAGGAGGAAGG - Intronic
1164566345 19:29328795-29328817 CTGGGTCCTGGGGAGGAGGGAGG - Intergenic
1164592277 19:29513441-29513463 AGGGGGCATGAGGAGGAAGAAGG + Intergenic
1164925824 19:32129206-32129228 TTGGGTCCTGAGGAGTGGGTAGG + Intergenic
1165741649 19:38208439-38208461 TGGGGACAGGAGCAGGAGGAGGG - Intergenic
1165829445 19:38723272-38723294 TTGGGGCCTGAGGAGGGGTAGGG - Intronic
1166268722 19:41700757-41700779 TTGAGCCAAGAGGAGGAGCAAGG - Intronic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
1167299851 19:48672153-48672175 GTGGGTAATGAGGAGGAGAGAGG + Intronic
1167644216 19:50697047-50697069 TGGGGTCAGGAGGGGAAGGACGG - Intronic
1167654128 19:50752504-50752526 TTGGGGCATAAGGAGGAGGCGGG - Intergenic
1167655827 19:50763646-50763668 TTGGGGCATAAGGAGGAGGCGGG - Intergenic
925060657 2:887549-887571 TTGGGTCAAGACAAGGAAGAGGG - Intergenic
925073284 2:988026-988048 TGAGGTGATGAGGAGGAAGACGG - Intronic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925252623 2:2452972-2452994 TCAATTCATGAGGAGGAGGAAGG + Intergenic
925329686 2:3048854-3048876 GTGGGCCATGAGGAGCAGGTGGG + Intergenic
925329729 2:3049058-3049080 TTGGGACATGAGGAGAAACATGG - Intergenic
925405932 2:3605471-3605493 GTGGGTGCTGAGGAGGGGGAGGG + Intronic
925405972 2:3605591-3605613 GTGGGTCCTGAGGAGGGGGAGGG + Intronic
925493801 2:4423917-4423939 TTGGGTAAAGCGGGGGAGGATGG + Intergenic
925788685 2:7458832-7458854 TTGGCTCATGAACAGTAGGATGG - Intergenic
925991781 2:9260284-9260306 CTGGGTCATGAGGATGAGGTGGG + Intronic
926577128 2:14594629-14594651 TTGGGTCTTGAGGATGAAGGTGG - Intergenic
926698184 2:15785078-15785100 GTGGGTCAGGATGAGGAGCAGGG + Intergenic
927381503 2:22484595-22484617 TTGGGTGCTGAAGAGAAGGAAGG - Intergenic
927415387 2:22874110-22874132 TTGGGACATGGGCAGGGGGAGGG - Intergenic
928613123 2:33010107-33010129 GGGGGACATGGGGAGGAGGAGGG + Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929573912 2:43040326-43040348 TTGGGTGATGAGGGGGAGAGGGG + Intergenic
929876326 2:45799993-45800015 GTGGGTCCTGGGGAGGAGGAAGG + Intronic
930154597 2:48093206-48093228 TTGGGGGAAGAGGAGGAGGCTGG + Intergenic
931094758 2:58926697-58926719 TTGGGTATTGAGGTGGGGGAGGG - Intergenic
931476005 2:62588137-62588159 TTTGAAGATGAGGAGGAGGAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933129013 2:78649737-78649759 TTGGGAGAGGAGGAAGAGGAGGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
934995342 2:98952718-98952740 CTGAGTCATGTGGAGGAGGCTGG - Intergenic
935053461 2:99544253-99544275 TGTGATGATGAGGAGGAGGATGG + Intergenic
936463072 2:112725824-112725846 TGGGGTCAGGTGCAGGAGGAAGG - Intronic
936868792 2:117108980-117109002 TTGGCACGTGGGGAGGAGGATGG - Intergenic
937745452 2:125407399-125407421 TGGGCTTATGAGGAGGAAGATGG - Intergenic
938143306 2:128813325-128813347 GTGGGTCATGGGCAGGAGGTAGG - Intergenic
938391597 2:130911125-130911147 TGAGGTCAGGAGGAGGAGGTGGG + Intronic
938792959 2:134692866-134692888 TGGGATCATGAGGAGGAGAGAGG - Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941629254 2:167865975-167865997 TAGGATGATGGGGAGGAGGATGG - Intergenic
942146922 2:173035907-173035929 TAGGCTCAGGAGGAGGAGAAGGG + Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
942871368 2:180738252-180738274 TGGGGTCTTGCGGTGGAGGAGGG - Intergenic
943669628 2:190648272-190648294 TTGGGACGGGAGGAGGAGGGAGG - Intronic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944209809 2:197195309-197195331 GGGGGTCATGAGCAGGAGAAAGG + Intronic
944444089 2:199772533-199772555 TGGGGTCATGGGGAGGATTAGGG - Intronic
946048079 2:216837780-216837802 TGGGGGGATGAGGAGGAGCAAGG - Intergenic
946189980 2:218003032-218003054 TGGGGGGAGGAGGAGGAGGAGGG - Intergenic
946446608 2:219745564-219745586 TTGGGGCTTGAGCAGCAGGAAGG + Intergenic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946504100 2:220280685-220280707 AAGGGTTATGAGGAGCAGGAAGG - Intergenic
947022297 2:225693352-225693374 ATGGGTTTTGAGGAGGAAGATGG + Intergenic
947117114 2:226783391-226783413 ATGTGGCATGAGGAAGAGGAAGG - Intronic
947125590 2:226865246-226865268 TTGCGTCTTGAAGAGGAGGCTGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948449413 2:238060236-238060258 TTGGGGCATGAGGGACAGGAAGG - Intronic
948479217 2:238239850-238239872 GTGGGCCGTGAGGATGAGGACGG - Exonic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168809431 20:694571-694593 TTGGTTCCTGAGGAAGGGGAGGG + Intergenic
1170146660 20:13182531-13182553 CTGGATCATGAGGAGGTTGAGGG - Intergenic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173406323 20:42768983-42769005 CTGGGTCATGAGAATGAGGCAGG - Intronic
1174062836 20:47844695-47844717 TTGAGTCCTGAGGAGGGAGACGG + Intergenic
1174072882 20:47910975-47910997 TTGAGTCCTGAGGAGGGGGAAGG - Intergenic
1174250378 20:49215099-49215121 TTGGGCCAGGAGGATGAGGATGG - Intergenic
1174741037 20:53014587-53014609 TTTAGTCAAGAGGAAGAGGAGGG - Intronic
1175133704 20:56807813-56807835 TTGGCAAATGAGTAGGAGGAAGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175764965 20:61586034-61586056 TGTGGTGATGAGGAGGATGATGG + Intronic
1176305024 21:5118767-5118789 GTGGGCCACGAGCAGGAGGAAGG - Exonic
1178105755 21:29317502-29317524 TTGGGGCCTGTGGAGCAGGAAGG + Intronic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1178964745 21:37105647-37105669 ATGGATCATGACTAGGAGGAGGG - Intronic
1179492308 21:41748752-41748774 CTGGGGCTTGAGCAGGAGGAAGG + Intronic
1179852031 21:44143263-44143285 GTGGGCCACGAGCAGGAGGAAGG + Exonic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1181114886 22:20625812-20625834 AGGGGGTATGAGGAGGAGGAGGG - Intergenic
1181164187 22:20974630-20974652 TGGGGTCATGAGGGGCAGGGTGG + Intronic
1181515836 22:23411974-23411996 TTGGCTCATGAGATGAAGGAAGG + Intergenic
1181595262 22:23910315-23910337 TTGGGTGAAGAGTTGGAGGAGGG - Intergenic
1182692058 22:32171102-32171124 TTGGGGGATAGGGAGGAGGATGG + Intergenic
1182926347 22:34129023-34129045 ATTGATCATGTGGAGGAGGAAGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1185003451 22:48261284-48261306 GATGGTGATGAGGAGGAGGATGG - Intergenic
1185052178 22:48559678-48559700 CTGAGCCTTGAGGAGGAGGAAGG + Intronic
950063533 3:10092454-10092476 TTGTGGCATAAGTAGGAGGAAGG - Intronic
950201994 3:11050984-11051006 TCTGGTATTGAGGAGGAGGAGGG - Intergenic
950575954 3:13832159-13832181 GAGGATCTTGAGGAGGAGGAGGG - Intronic
950575970 3:13832240-13832262 TGGGAGCAAGAGGAGGAGGAGGG - Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951613733 3:24520442-24520464 TTGGGCCATGAGATGGAGAAGGG - Intergenic
953126229 3:40094048-40094070 TTGGGACATGTGAAGGGGGAGGG - Intronic
953763781 3:45716697-45716719 ATGGGCCATGAGGGGGATGAGGG + Intronic
954283834 3:49603552-49603574 ATGGGTCAGGAAGAGGATGAAGG + Intronic
954419895 3:50413188-50413210 GTGGAGCATGAGGAGGGGGAAGG + Intronic
955298040 3:57751445-57751467 TTGGGGCACGGGGACGAGGAAGG - Intergenic
955888023 3:63620974-63620996 TTGGGACATGAAGAATAGGAAGG + Intergenic
956783036 3:72619420-72619442 TTGGGTCATGATTTGGAGAAAGG - Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957192507 3:77028086-77028108 GTGGGTTATGAAGAGGAGTAAGG - Intronic
958054489 3:88391898-88391920 TTAGATAATGAGGTGGAGGAAGG + Intergenic
959975836 3:112458366-112458388 TTGGGCCATCAGTAGAAGGAAGG - Intergenic
960164010 3:114381290-114381312 TTGGGACATGAGGAAGAGAAGGG + Intronic
960556741 3:119038408-119038430 TTGGGCTATGGGGAGGAGGATGG - Intronic
960940870 3:122933073-122933095 TTGGGGGATGAGGAAGAGGATGG - Intronic
961254871 3:125540892-125540914 AAGGAGCATGAGGAGGAGGAAGG + Intronic
961321416 3:126078916-126078938 TTTTGCCATGAAGAGGAGGAGGG - Intronic
961774236 3:129272459-129272481 TGGGGTCAGGAGGAGGTGGGCGG + Intronic
962167304 3:133062994-133063016 TTTGGACATGAGGAGGGTGAGGG + Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962417090 3:135192997-135193019 TGGGATCCTCAGGAGGAGGATGG + Intronic
962917551 3:139918254-139918276 TTGCATCATGAAGAGGAGGCAGG - Intergenic
963112540 3:141699259-141699281 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
964607431 3:158572649-158572671 TTGGGGCGTGAGGTGGAGGGAGG + Intronic
964724365 3:159799037-159799059 TTGGGTAATGAAGAGGGAGAGGG + Intronic
965888504 3:173479202-173479224 TTGGTTCCTGAGGAGATGGAAGG + Intronic
966466891 3:180239189-180239211 TTTAGTTATGAGGAGGAGAATGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967061763 3:185879088-185879110 GTGGCTGATGAGGTGGAGGAAGG + Intergenic
967314698 3:188140706-188140728 ATAGGTCTTGAGGAGCAGGAGGG - Intergenic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
967794935 3:193589749-193589771 GTGGGTCATGAGTGGGAGGGAGG - Intronic
968625812 4:1626200-1626222 TTGGCCCAGGAGGAGGAGGTAGG + Intronic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969918175 4:10510565-10510587 TTGGGTCATGATGGGAAGTAGGG + Intronic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
971811200 4:31430051-31430073 TTAGGCCCTGAGGAGGAAGAAGG - Intergenic
972645259 4:40961989-40962011 GAGGGTCTTGAGGAGGAGAATGG - Intronic
973651021 4:52997277-52997299 TTGGGGCTTGAGTGGGAGGAGGG - Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974089072 4:57291726-57291748 TTGGGCCATGAGGTTGAGAATGG + Intergenic
974813579 4:66977108-66977130 GGGTGTCATGAGGAGGAGCAAGG + Intergenic
975936077 4:79582512-79582534 TGGTGTGAAGAGGAGGAGGATGG + Intergenic
976440227 4:85064876-85064898 TTGGGTTTTGGGGAGGAGTAAGG + Intergenic
980350297 4:131675401-131675423 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
980449919 4:132958187-132958209 CTGTGTCATGAGGATAAGGAGGG + Intergenic
980857505 4:138456860-138456882 TTCTGTCATGAGGAGAGGGATGG + Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982295883 4:153828667-153828689 TTAGGTCATTGGCAGGAGGAAGG - Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
983990055 4:174107659-174107681 TTGGTTTCAGAGGAGGAGGAAGG + Intergenic
985026459 4:185743979-185744001 GGGGGACAGGAGGAGGAGGAGGG - Intronic
985985747 5:3515015-3515037 TTCACTGATGAGGAGGAGGATGG - Intergenic
985992732 5:3576697-3576719 TTGGGTCAGGATAAGCAGGAGGG + Intergenic
986029694 5:3882696-3882718 TGGGGTCATGGGGATGAGGTGGG + Intergenic
986165869 5:5271138-5271160 CTGGGTGCTGAGGAGGAGGCTGG - Intronic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
986635063 5:9812941-9812963 ATGGGTTATGAGCAGAAGGAAGG + Intergenic
987471001 5:18327562-18327584 TGGGGTCATGGGGTGGAGGGCGG - Intergenic
989110497 5:37902392-37902414 TGGGGCCCAGAGGAGGAGGAAGG - Intergenic
989242788 5:39219679-39219701 TTGAGTAATAAGGAGGAGAAAGG + Intronic
989339456 5:40356767-40356789 TTGGGTGATGAGGGGGAAGAAGG - Intergenic
990209348 5:53465832-53465854 TTGGGTTCTGAGGAAGAGAAAGG - Intergenic
991499396 5:67261824-67261846 TGGGCTCAGGAGGAGGAAGAAGG + Intergenic
991537815 5:67692197-67692219 AAGGGTCATGAGGAGTAAGAGGG - Intergenic
991705489 5:69354067-69354089 TTGGGTGGTGAGGGGGAGGCAGG - Intronic
992565853 5:77994704-77994726 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565862 5:77994736-77994758 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565871 5:77994768-77994790 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565880 5:77994800-77994822 TGGGGTCAGGAGGCAGAGGAGGG - Intergenic
992565889 5:77994832-77994854 TTTGGTCAGGAGGCAGAGGAGGG - Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993879557 5:93346846-93346868 TGGGGTCAGGAGAAGGGGGAGGG - Intergenic
998097360 5:139403813-139403835 TGGCGTCATCAGGAGGAGGCCGG - Intronic
998960786 5:147484242-147484264 TTTGGTGAAGGGGAGGAGGATGG - Intronic
999252955 5:150193406-150193428 TTGGCTCATGAGCAGGAAGAAGG - Intronic
1000153414 5:158526419-158526441 TTGGGGCATGAAGAAGAGGAAGG + Intergenic
1001555880 5:172637020-172637042 TTGAGTTGTGAGGAGGAGGCTGG + Intergenic
1001690796 5:173631279-173631301 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690813 5:173631329-173631351 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690846 5:173631429-173631451 ATAGGAGATGAGGAGGAGGAGGG - Intergenic
1001947817 5:175795373-175795395 GTGGGTCATGAGGAGGCAGGAGG + Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002184488 5:177447669-177447691 CTCGGCCGTGAGGAGGAGGAGGG - Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1003187694 6:3847418-3847440 TTGGTTCATGAGGCTGAGGAAGG - Intergenic
1004402941 6:15305463-15305485 GTAGGGCAAGAGGAGGAGGATGG - Intronic
1004744832 6:18499434-18499456 TTGAGTGCTGAGAAGGAGGAGGG + Intergenic
1004978953 6:21001005-21001027 TTTGGTGATGATGAGGAGCAGGG - Intronic
1005402528 6:25449368-25449390 TTAGGTTCTGAGGAGGAGGATGG + Intronic
1005890753 6:30135938-30135960 TTTGCTCAAGGGGAGGAGGAAGG - Intergenic
1006163164 6:32049629-32049651 TTGGGTCCTGGGGAAAAGGAGGG + Intronic
1006809096 6:36808422-36808444 GTGGGTGATGAGGAGGAAGAAGG - Intronic
1006863572 6:37190310-37190332 ATGTGTCATGAGGAGTTGGAAGG - Intergenic
1007176511 6:39901415-39901437 AGAGGCCATGAGGAGGAGGAAGG + Exonic
1007341481 6:41193909-41193931 TAGGGTCAGGGGGATGAGGATGG - Intronic
1007471015 6:42090434-42090456 TTTGGGCGTGAGGAGGAAGAGGG + Intergenic
1011060091 6:83255672-83255694 ATAGGTGATGAGGAGAAGGATGG - Intronic
1011483332 6:87816793-87816815 ATGGGTCATTAAGAGGAGTAGGG + Intergenic
1012422149 6:99077319-99077341 TGGGGGCATGAGGAAGAGCAGGG + Intergenic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1014963097 6:127711557-127711579 GTGGATCATGAGGAGAGGGAAGG - Intronic
1015077656 6:129180827-129180849 TGGGGTCATGGGGTGGAGGGTGG + Intronic
1015754047 6:136590010-136590032 TTGGGTCATGAGGCTCATGAAGG + Intronic
1016642960 6:146371597-146371619 TTGGGGCATGGGGAGGAGATGGG - Intronic
1016915471 6:149240257-149240279 TTGGCTCAAGAGGAGGGGAAGGG + Intronic
1017819772 6:158040942-158040964 TTGGGTCGTGGGAAGAAGGAGGG - Intronic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1018038830 6:159904136-159904158 TGGGGAGATGAGGAGGAAGAAGG - Intergenic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018742663 6:166742513-166742535 TTGTGTCAGGAGGAGGCAGAAGG - Intronic
1019030007 6:169001798-169001820 ATGGGGCATGCAGAGGAGGAGGG + Intergenic
1019126398 6:169843265-169843287 GTGGCTAATGAGGAGAAGGATGG - Intergenic
1019364257 7:623704-623726 TGGGGTCTTGCGGTGGAGGAAGG - Intronic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1022938271 7:35203422-35203444 TTGGCAGATGAGGAAGAGGAGGG - Intronic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1024610036 7:51056229-51056251 TGGGGGCATGAGGAAGAGCAGGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1026388982 7:69880470-69880492 TATGATGATGAGGAGGAGGATGG - Intronic
1026523928 7:71138421-71138443 GTAGGTGAGGAGGAGGAGGAAGG + Intronic
1026566486 7:71493777-71493799 TGGGATGATGAGGAGAAGGATGG - Intronic
1026726942 7:72877358-72877380 TTAGGTCATGATGGGAAGGAGGG + Intergenic
1027116891 7:75488261-75488283 TTAGGTCATGATGGGAAGGAGGG - Intergenic
1027274913 7:76547337-76547359 TTAGGTCATGATGGGAAGGAGGG + Intergenic
1027601402 7:80245520-80245542 TACGGTCTTCAGGAGGAGGAAGG - Intergenic
1028479299 7:91287217-91287239 TGGGGTCAGGAGGGGGATGATGG - Intergenic
1028505208 7:91562850-91562872 TTTGTTCATGAGGTGGAGAAAGG - Intergenic
1028716718 7:93979515-93979537 ATGTGTCATGGGGAGAAGGAAGG - Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029720610 7:102361800-102361822 TTAGGTCATGATGGGAAGGAGGG + Intergenic
1030047719 7:105512497-105512519 TTGTGGCATAAGGAAGAGGAAGG + Intronic
1035575688 8:703267-703289 GTGGGGCCTTAGGAGGAGGATGG - Intronic
1035648090 8:1243713-1243735 TTGGGACTTGAGGAGGATCAGGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036498410 8:9291575-9291597 TTTGGTGATAAGGAGCAGGAAGG + Intergenic
1037497874 8:19458057-19458079 TTGAGTCTTGAGGAGGAGAGAGG - Intronic
1037784327 8:21893495-21893517 TTGGGGCATTGGGCGGAGGAAGG + Intergenic
1037881174 8:22574177-22574199 TCGTGTCTTGAAGAGGAGGAGGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039481270 8:37875097-37875119 TTGGGGGATGGGGAGGAGGACGG + Exonic
1039772179 8:40698574-40698596 TTGGATGGTGAGGAGGATGAGGG + Intronic
1040499280 8:47992827-47992849 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
1040548728 8:48422317-48422339 TGGAGCCAGGAGGAGGAGGAGGG + Intergenic
1041833228 8:62180535-62180557 TTGGGTCATGGGGAGGGCGCAGG + Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1043506336 8:80906846-80906868 TTGGGACATGAGGAGAAAGATGG - Intergenic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046366573 8:113239650-113239672 ATGGGTAATGAGTAGGAGGGTGG + Intronic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1052265316 9:26565284-26565306 TTGAGTCATTTGGAGGAGGCAGG - Intergenic
1052764827 9:32630391-32630413 TATGATGATGAGGAGGAGGATGG - Exonic
1052974298 9:34400346-34400368 ATGGGGCAAGAGGAGGAAGAAGG + Exonic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053067042 9:35076125-35076147 ATGGGCCCTGAGGAGGAGAAAGG + Intronic
1053146090 9:35713045-35713067 TTGGGAGATGAGGAGAAAGAGGG + Intronic
1053782412 9:41624310-41624332 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1054170367 9:61834467-61834489 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1054667170 9:67746348-67746370 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
1055541858 9:77316902-77316924 TAGAGTTATGAAGAGGAGGAAGG - Intronic
1055681561 9:78721042-78721064 GTGAGTGCTGAGGAGGAGGATGG + Intergenic
1056287194 9:85101448-85101470 TAGGGTCATGGGTAGGAGGAAGG - Intergenic
1056300177 9:85232237-85232259 GTGGGTCATGAGGAGGATGGTGG - Intergenic
1056647791 9:88429919-88429941 GTAAGTCAAGAGGAGGAGGAAGG + Intronic
1056723294 9:89089745-89089767 TGGGGGCATGAGGATGGGGAGGG + Intronic
1057523292 9:95777687-95777709 TTGGACCATGAGGATGAAGATGG - Intergenic
1057775198 9:98002174-98002196 GTGGTTAATGAGGATGAGGATGG - Intronic
1057824031 9:98358679-98358701 TTGGGGCATGAGGAGGCTGTGGG + Intronic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1059343607 9:113613442-113613464 GTTGACCATGAGGAGGAGGAAGG + Intergenic
1059702631 9:116790447-116790469 GTGGGTCATGAAGGGGTGGAGGG - Intronic
1059815465 9:117908178-117908200 TTGGGTCTTGGGGAGGGAGATGG - Intergenic
1060143218 9:121228189-121228211 TGGGGACAGAAGGAGGAGGAAGG - Intronic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060887171 9:127162641-127162663 CTGGGTCTTGAGGAGTAGGCAGG + Intronic
1060907906 9:127324407-127324429 TTGGGCCAGAAGGAGGATGAGGG + Intronic
1061196790 9:129110951-129110973 TTGAGACCTGTGGAGGAGGAAGG + Intronic
1061409734 9:130413611-130413633 TTGGGACCTGAGGAGCAGCATGG + Intronic
1061569453 9:131467815-131467837 GTGGGGCATGGGGACGAGGAGGG - Intronic
1062006651 9:134241801-134241823 TTTGGTCACGAGCAGGTGGATGG + Intergenic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062417996 9:136463137-136463159 TTGGGTCAACAGGAACAGGAAGG + Intronic
1203779885 EBV:95481-95503 ATTGGTGATGAGGACGAGGATGG + Intergenic
1185825255 X:3243377-3243399 TAGGCTCATGTGCAGGAGGAGGG - Intergenic
1185872100 X:3673087-3673109 TTGGGTCTAGAGGAGAAGGCAGG + Intronic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186498572 X:10032267-10032289 ATGGGCCAGGAGGAGGATGATGG + Intronic
1186838266 X:13459371-13459393 TTGGGACATGGAGAGGAAGAAGG + Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1189376702 X:40472293-40472315 TTGGGGTGTGGGGAGGAGGAGGG - Intergenic
1189476706 X:41361678-41361700 TTGGGTTGTGAGGAGAAAGAGGG - Intronic
1189720350 X:43909653-43909675 TTGGGCCAGGAGGATCAGGAAGG - Intergenic
1190130985 X:47748849-47748871 TTGGATCAAGAGGTGGTGGATGG - Intergenic
1190619391 X:52269962-52269984 GTGGGTCATGGAGGGGAGGAAGG + Intergenic
1190753153 X:53379822-53379844 ATGGGTGATGAGGGGGAGGAAGG + Exonic
1192230438 X:69260998-69261020 TTGGGACAGGAGGGGTAGGAGGG - Intergenic
1192350799 X:70354857-70354879 TGGGGCCAGGATGAGGAGGAAGG + Intronic
1192477867 X:71459207-71459229 TATGATGATGAGGAGGAGGATGG + Intronic
1192624871 X:72715952-72715974 TTTGGTAATGATGATGAGGAAGG + Intergenic
1193102136 X:77626279-77626301 TTGGGGTAAGAGTAGGAGGAGGG + Intronic
1193370090 X:80685517-80685539 TAGGGTCATCAGGAGCAAGAGGG - Exonic
1193699238 X:84742551-84742573 AGGGGTAATGAGGAGGAGGGAGG - Intergenic
1196782821 X:119398969-119398991 TGGAGGCAAGAGGAGGAGGAGGG + Intergenic
1198201037 X:134419021-134419043 TTGTTTTTTGAGGAGGAGGAAGG + Intronic
1199459016 X:148062140-148062162 TGGGGTCCTGAGGAGGAGGTGGG - Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1200842914 Y:7801950-7801972 TTGGAACATGAGGAGTAGGGGGG - Intergenic
1201743130 Y:17344473-17344495 TGGGGTAATGAGGAGGAGAGGGG + Intergenic