ID: 1187959859

View in Genome Browser
Species Human (GRCh38)
Location X:24558169-24558191
Sequence GGCAGGGGGCGCGCAGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187959847_1187959859 11 Left 1187959847 X:24558135-24558157 CCATTTGAGAGCAAGAATGGGAT 0: 1
1: 0
2: 0
3: 20
4: 162
Right 1187959859 X:24558169-24558191 GGCAGGGGGCGCGCAGAGTTGGG 0: 1
1: 0
2: 1
3: 17
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187959859 Original CRISPR GGCAGGGGGCGCGCAGAGTT GGG Intronic
900101039 1:962221-962243 GGGAGGGGCCGAGCAGAGTCAGG - Intronic
900208663 1:1442406-1442428 GGCTGGGGGCGGGCAGCGCTGGG + Exonic
900316752 1:2060812-2060834 GGCAGGGGGCGGGGAGGCTTTGG + Intronic
900337098 1:2169706-2169728 GGGTGGGTGCGCGCGGAGTTGGG + Intronic
900407364 1:2498534-2498556 GGCAGGGGGTCCTCCGAGTTGGG - Exonic
901225732 1:7611960-7611982 GGGAGGGGGTGCACAGAGATGGG + Intronic
902457736 1:16548098-16548120 GGCACGGGGCGCCCAGGGCTCGG - Intergenic
902475180 1:16680439-16680461 GGCACGGGGCGCCCAGGGCTCGG - Intergenic
902494426 1:16859815-16859837 GGCACGGGGCGCCCAGGGCTCGG + Intronic
902561541 1:17280643-17280665 GGCAGGGGAGGGCCAGAGTTGGG - Intronic
903259091 1:22121585-22121607 GGCAGAGGGAGGGCAGAGCTGGG + Intronic
906514499 1:46431052-46431074 GGGAGGAGGCCAGCAGAGTTGGG + Intergenic
907313208 1:53551714-53551736 GGCAGAGGGAGGGCAGAGGTGGG - Intronic
908495004 1:64685939-64685961 GGCAGGGTGGGCACAGAGGTAGG - Intronic
908544308 1:65148574-65148596 GGCCGGGGGCGAGCCGCGTTGGG + Intronic
912969692 1:114269124-114269146 GGCAGGGGAAGAGGAGAGTTTGG + Intergenic
913610142 1:120503022-120503044 GCCAGGGGGCGCTCACAGGTGGG - Intergenic
913991775 1:143620027-143620049 GGCAGGGGAGGCGGAGAGCTCGG - Intergenic
914581048 1:149019217-149019239 GCCAGGGGGCGCTCACAGGTGGG + Intronic
914991516 1:152503047-152503069 GGCAGGGAGCGCCCAGAGCTGGG + Intergenic
916108511 1:161447483-161447505 GGAAGGAGGCGCGCGGTGTTTGG - Intergenic
916110099 1:161454864-161454886 GGAAGGAGGCGCGCGGTGTTTGG - Intergenic
916111684 1:161462274-161462296 GGAAGGAGGCGCGCGGTGTTTGG - Intergenic
916113271 1:161469655-161469677 GGAAGGAGGCGCGCGGTGTTTGG - Intergenic
920912558 1:210232572-210232594 GGCAGGGGGCGGGCTGGGGTGGG + Intergenic
922125073 1:222713381-222713403 GGAAGTGGGCGCTCAGAGCTCGG + Intronic
922440951 1:225654083-225654105 GGCAGGGGGCGGGGAGAGAGAGG + Intergenic
924740997 1:246794132-246794154 GGCAGGGGGAGGGCAGGGTTGGG + Intergenic
1063178887 10:3578305-3578327 GGCAGGGAGAGAGGAGAGTTGGG - Intergenic
1063400632 10:5741481-5741503 GTCAGGGGGGCTGCAGAGTTGGG - Intronic
1068989036 10:63132543-63132565 GGCAGGGGGCGGGCAGAGGGAGG + Intergenic
1072723471 10:97796075-97796097 GGCAGGGGGCGCTGAGAGCAGGG - Intergenic
1073465413 10:103692341-103692363 GCCAGGGCCCGCCCAGAGTTTGG - Intronic
1075055510 10:119215494-119215516 GGAAGGGGGTGCGGAGAGTGAGG + Intronic
1075627011 10:123970785-123970807 GGCAGGGGGCGGGCAAGGTGGGG - Intergenic
1076826201 10:132970916-132970938 GGCAGGGTGCCCTCAGAGCTGGG + Intergenic
1077536802 11:3128426-3128448 GGCAGGGGTTGTGCATAGTTAGG + Intronic
1078902075 11:15650873-15650895 GGCAGGGGGCCTGGAGAGTTAGG - Intergenic
1080661044 11:34296214-34296236 AGCAGGGAGAGGGCAGAGTTGGG + Intronic
1081638999 11:44740126-44740148 GGCAAGGGGCGGGCAGAGATCGG - Intronic
1081991225 11:47338678-47338700 AGCTGGGGGGGTGCAGAGTTGGG + Exonic
1083966993 11:66049191-66049213 GGCGGGGGGCGGGCAGAGCCGGG - Intergenic
1084154025 11:67303900-67303922 GGCGGGGGGCGCGCTCAGATCGG - Intronic
1085316559 11:75548612-75548634 GGCAGGGTCTGGGCAGAGTTGGG + Intergenic
1085384633 11:76149992-76150014 GGCAGTGGGCGTGCACAGTGGGG + Intergenic
1089661490 11:119989007-119989029 GGCAGAGGGGGCTCAGAGGTGGG - Intergenic
1090058039 11:123440005-123440027 GGGAGGGGGAGCGCCCAGTTTGG + Intergenic
1090388835 11:126374094-126374116 GGGAGGGGGCCTGCAGTGTTGGG + Intronic
1090392084 11:126395312-126395334 GGGAGGGGGCCTGCAGTGTTGGG + Intronic
1090684526 11:129100652-129100674 GGCAGGGTGCAGGCAGGGTTGGG - Intronic
1091069609 11:132550759-132550781 GGCAGGTGGAGTGTAGAGTTGGG - Intronic
1091885896 12:4016834-4016856 GGCAGGGAGCGGGGAGAGGTTGG + Intergenic
1092154670 12:6274495-6274517 GGCAGGGGCAGGACAGAGTTTGG - Intergenic
1095672559 12:44877004-44877026 GGCAGGGGGCGCGCGGGTTCCGG - Exonic
1096034727 12:48456559-48456581 GGCAGGCGAGGAGCAGAGTTGGG - Intergenic
1096466053 12:51848312-51848334 GGGAGGGGGCGGGCAGAGCAGGG - Intergenic
1096670292 12:53194424-53194446 GGCAGGGTGCTGGCAGAATTGGG - Exonic
1097183599 12:57184619-57184641 GGCAGGGGTCGCTCAGAAGTGGG + Intronic
1098236118 12:68420070-68420092 GGGAGGGGGTGCGTAGAGTGGGG - Intergenic
1100426517 12:94492285-94492307 GGCAGGGGGTTTGGAGAGTTTGG + Intergenic
1104807578 12:131599294-131599316 GGCAGGGGGCCTGCAGGGCTCGG - Intergenic
1113179540 13:107609408-107609430 GACTGGGGCCGCCCAGAGTTGGG - Intronic
1113800175 13:113082403-113082425 TGCAGGGAGAGCGCAGAGGTCGG - Intronic
1114493429 14:23117423-23117445 GGATGGGGGTCCGCAGAGTTAGG + Exonic
1115480707 14:33858461-33858483 CCCAGGGGGCGGGCAGAGCTGGG - Intergenic
1117920640 14:60723071-60723093 GGTAGGGGGCGGGGAGAGGTGGG + Intronic
1119330154 14:73787346-73787368 AGCCGAGGGCGCGCAGAGTGGGG - Intronic
1119686875 14:76640149-76640171 GGAAGGGGGCGGGCAGAGGAAGG - Intergenic
1119693366 14:76694037-76694059 GGCAGGGGGCTGGCAGGGGTTGG + Intergenic
1119728354 14:76935836-76935858 GGCTGGGGGCTGGCAGAGCTGGG - Intergenic
1120751163 14:88199520-88199542 GGCAAGGGGAGAGCAGTGTTAGG + Intronic
1121409017 14:93736486-93736508 GGCAGAGGGGGCTCTGAGTTTGG + Intronic
1121634821 14:95446771-95446793 GGCCTGGGCTGCGCAGAGTTCGG - Intronic
1123006211 14:105325050-105325072 GGCAGGGGGTGCCCACAGCTTGG - Intronic
1124022001 15:25933719-25933741 GGCAGGGGGCGGGCAGAGAGTGG - Intergenic
1127259432 15:57317489-57317511 GGCAGAGGGAGCTCAGAGATGGG - Intergenic
1132231271 15:100186046-100186068 GGCAGTGGCCGCCTAGAGTTGGG + Intronic
1132527561 16:425353-425375 GGCAAGAGGCGCGCGGAGTCAGG - Intergenic
1132831418 16:1930070-1930092 GGCAGGTGCCGCGCAGAGCCTGG - Intergenic
1132836261 16:1954768-1954790 GGCAGGGGCGGGGCAGTGTTGGG + Intronic
1132956690 16:2598120-2598142 GGCAGGGCGGGCGCATGGTTCGG - Exonic
1134610175 16:15601670-15601692 GGCAGTGGGCGCGCTGAGGAGGG - Intronic
1135298259 16:21301706-21301728 GGCTGGGGGCGCGCAGTGCGCGG - Intronic
1141594140 16:85087188-85087210 GGCAGGAGGCGGGCAGGGCTGGG + Intronic
1142225929 16:88877670-88877692 GGCAGGGGTGGGGCAGAGGTGGG - Intronic
1142508908 17:382301-382323 GGCAGGGGACGCCCAGAGCAGGG - Intronic
1143083333 17:4397361-4397383 GGCAGGGGGCGGGAGGAGGTGGG + Intergenic
1143355750 17:6327132-6327154 GGCAGGGGGCGCACTGGGCTGGG - Intergenic
1144775516 17:17782912-17782934 GGCAAGGGGCGCGCAGGGCGGGG - Intronic
1146386053 17:32374444-32374466 GGCAGGGGGATCGCAAAGTCAGG - Exonic
1147424993 17:40342127-40342149 GGGAGGGGGCGCGCAGAGCTGGG + Intronic
1147840666 17:43369114-43369136 CGGAGGGGGCGCGCAGAGGGAGG + Intergenic
1148048706 17:44759060-44759082 GGCGGGGGTCGCGGAGAGGTGGG - Exonic
1150226641 17:63528087-63528109 GGCAGGGAGAGGGCAGAGCTGGG - Intronic
1150502689 17:65666148-65666170 GTCAGGGAGCTCCCAGAGTTCGG - Intronic
1150625450 17:66838302-66838324 GGCCTGGGGGGAGCAGAGTTCGG + Intronic
1152087985 17:78231950-78231972 GGCGGGGGGCGCGCGGAGCCGGG - Exonic
1152158001 17:78647566-78647588 GGCAGGGTGGGTGCAGAGGTGGG + Intergenic
1152406598 17:80101557-80101579 GCCCGGGGGCGCGCAGAGGCGGG - Intergenic
1153323333 18:3794111-3794133 GGGAGGAGACGTGCAGAGTTAGG - Intronic
1157137586 18:45071938-45071960 GGCATGGGATGCGGAGAGTTGGG - Intergenic
1157860125 18:51133711-51133733 GGCAGGGGTTGGGCAGAGTGGGG + Intergenic
1158505716 18:58044537-58044559 GGCAGGGCGTGCGCAGGGTAGGG + Exonic
1160843165 19:1155411-1155433 GGCAGAGGCCGCGGACAGTTGGG - Intronic
1160873022 19:1285693-1285715 GGCGGGGGGCGCGCAGAATCGGG + Intergenic
1160874527 19:1290980-1291002 GACAAGGGGCGCACAGAGCTGGG - Intronic
1160920242 19:1516185-1516207 AGCAGGGGCCACGCAGAGTTGGG + Intergenic
1161004880 19:1930120-1930142 GGCAGGGGGCTGGGAGAGTGAGG + Intergenic
1161313273 19:3606641-3606663 GGCTGGGGGCGGGCAGAGGGAGG + Exonic
1161352843 19:3803464-3803486 GGCAGGCGGGGAGCAGAGTGGGG - Intergenic
1161384487 19:3983725-3983747 AGTAGGGGGAGCGCAGAGTACGG - Intronic
1161510808 19:4670093-4670115 GGGAGGGGGCGCGGAGCATTGGG - Intronic
1162462158 19:10819675-10819697 GGGAGGGTGCGGGTAGAGTTAGG + Intronic
1163117163 19:15195721-15195743 GGGAGGGGGCGCGCTGCGCTGGG + Intronic
1163282328 19:16325367-16325389 GGGCGGGGGCGCGCCGGGTTCGG - Exonic
1163289503 19:16370247-16370269 GGCAAGGGGCGCGCTGACTCAGG + Intronic
1164398697 19:27888105-27888127 GGCAGGGGATGGGCAGAGTGGGG + Intergenic
1166094140 19:40529258-40529280 GCCAGGGGGCGCGCGGAGCCGGG + Intronic
1166305817 19:41936349-41936371 GGAAGGGGCTGCTCAGAGTTGGG + Intergenic
1166997787 19:46728077-46728099 GGCAGGGGGCCCTCAGTGTGGGG - Intronic
1167019254 19:46861534-46861556 GGGAAGGGGGGCGCAGAATTGGG - Intergenic
1167072338 19:47228240-47228262 GGCGGTGGGGGCGCAGAGGTAGG + Exonic
1167793524 19:51694637-51694659 GGAAGGAGGCCCCCAGAGTTGGG + Intergenic
1168324255 19:55530081-55530103 CGGCGGGGGCGCGCAGAGCTCGG + Exonic
925378317 2:3404888-3404910 GGGAGGGGGCGCAAAGAGTGAGG + Intronic
925379724 2:3416688-3416710 GGCAGGGGGAGCGCAGTGATGGG - Intronic
925379749 2:3416758-3416780 GGCAGGGGGAGGGCAGTGATGGG - Intronic
926146246 2:10398663-10398685 GGCAGGGGACGGGCAGAGGGTGG - Intronic
927146579 2:20170072-20170094 GGCAGGGGGCAGGCACAGCTGGG + Intergenic
927721274 2:25384140-25384162 GGCTGGGGGCGTGCAGTGTGGGG + Intronic
927956665 2:27211968-27211990 GGCAGGGGGCGGGCAGGGGGCGG - Intronic
927964307 2:27259683-27259705 GGCATGAGGCTCACAGAGTTGGG + Intronic
932236362 2:70124140-70124162 GGAAGGGGGCGGGGAGAGCTGGG + Intergenic
936346137 2:111676793-111676815 GGCAGGGGGCCCGGGGAGTGGGG + Intergenic
936518426 2:113197098-113197120 GGCAGGTGGTGCTCAGAGTGGGG + Intronic
941164929 2:162074275-162074297 GGCAGCCGGGGCGCAGAGTGCGG + Exonic
943401020 2:187410888-187410910 GGCAGGGGGCGGGGAGAGGTAGG + Intronic
946966515 2:225042586-225042608 GCCCGGGGGAGCGCAGAGTTTGG - Intergenic
1169145711 20:3250985-3251007 GTCAGGGGGCTCCCAGACTTAGG + Exonic
1169214709 20:3786479-3786501 GGCGGGGGGCGCGCCGGGATGGG - Exonic
1170629882 20:18057339-18057361 GGAAGGGGGCGCCTAGAGTCTGG + Intronic
1172283927 20:33727842-33727864 GGAAGGGGGCGCTCACAGCTTGG + Intergenic
1172604109 20:36203012-36203034 GGCAGGGGGCGCTCTGAGCAAGG + Intronic
1172865247 20:38090975-38090997 GGCAGGGGAAGCGGGGAGTTGGG + Exonic
1173586339 20:44186296-44186318 AGCTGGGGGCCCGCAGAGGTGGG - Intronic
1173916133 20:46709814-46709836 GCCAGGGGGCGCGCACTCTTAGG - Intronic
1174116745 20:48231468-48231490 GGCAAGGTGAGCCCAGAGTTGGG - Intergenic
1175231317 20:57475134-57475156 GGCACGGGGAGGGCCGAGTTGGG + Intergenic
1175812784 20:61867708-61867730 GGCAGGAGGCGAGCAGAGGAGGG + Intronic
1175825923 20:61936476-61936498 GGCAGGGGAGGCGGAGGGTTGGG - Intronic
1176028293 20:62997624-62997646 GGCAGGGAGGGGCCAGAGTTAGG - Intergenic
1178914166 21:36697854-36697876 GGATGGGGGCGCGGAGATTTGGG - Intergenic
1180064322 21:45405110-45405132 GGCAGGGGGCGGGCAGGGGCCGG - Intergenic
1180095478 21:45554024-45554046 GGGAGGGGGCGCGGGGAGATTGG - Intergenic
1180095604 21:45554287-45554309 GGGAGGGGGCGCGGGGAGATTGG - Intergenic
1182123579 22:27801320-27801342 GGCAGCGGGTGCGCTGCGTTCGG + Exonic
1182234263 22:28863288-28863310 GGCAGGGGGCTGGCAGGGGTAGG - Intergenic
1183231499 22:36584954-36584976 GGCAGGTGGCTCCCAGAGGTGGG - Intronic
1183978351 22:41526002-41526024 GGCAGAGGCCGCCCAAAGTTGGG - Exonic
1184238105 22:43197085-43197107 CGCAGGGGGCGCCCACATTTAGG - Intergenic
1184384074 22:44164367-44164389 GGCAGGAGGCCAGCAGAGCTGGG + Intronic
1184920213 22:47600639-47600661 GGCAGGGGGTGAGCAGAGGCTGG - Intergenic
1185337964 22:50279172-50279194 GGCAGGGGAAGGGCAGAGTGTGG - Intronic
949105438 3:196966-196988 GGACGGGGGCGCGCAGGGTCCGG - Exonic
949243056 3:1893828-1893850 GGCAGTGGGTGGGCAGAGTTTGG + Intergenic
949980659 3:9500197-9500219 TGGAGGGGGAGAGCAGAGTTAGG - Exonic
950345408 3:12288082-12288104 GGGAGGGGGCGCGGAGGGCTGGG + Intronic
950562540 3:13742984-13743006 GGCAGGTGGGGAGCAGGGTTTGG + Intergenic
952382643 3:32817071-32817093 CGCAGGGCGCGCGCGGAGCTCGG + Intergenic
954031765 3:47824950-47824972 CGCAGGGGGCGCGCGGCGCTCGG + Intronic
962389326 3:134958346-134958368 GGCAGGGGGAACCCAGAGCTGGG - Intronic
962416539 3:135187861-135187883 GGGAGGGGGAGTGCAGAGTAGGG - Intronic
963253019 3:143119759-143119781 GGCAGGAGCCGCGCAGAGGCTGG + Exonic
968081554 3:195849857-195849879 GGCAGGGGGCGCGCGCAGACAGG + Intergenic
969597621 4:8158112-8158134 GGCTGGAGACGCGCAGAGATCGG + Intronic
981713568 4:147732048-147732070 GGCCGCGGGCGCTCAGAGCTCGG + Exonic
983211672 4:164964732-164964754 GGCAAGGGGAGTGCAGAGTAGGG + Intronic
985805275 5:2038877-2038899 GGCAGGGGCCGGGCAGGGCTGGG + Intergenic
988077100 5:26367183-26367205 GACTGGGGGAGAGCAGAGTTGGG + Intergenic
989209624 5:38846150-38846172 GGCAGGGCGCGAGCAGAGCGGGG - Exonic
995187993 5:109291088-109291110 GGCAGGGTGCTGGCAGAGGTGGG - Intergenic
995566463 5:113436206-113436228 GGCAGTGGGCAGTCAGAGTTGGG - Intronic
995831736 5:116361770-116361792 GGCAGGGCGCGGGAAGAGTGCGG - Intronic
1001431329 5:171664958-171664980 GGCAGGGGGCACCCTGATTTTGG - Intergenic
1001591128 5:172866232-172866254 GGCAGGAGGAGAGCAGAGTGGGG + Intronic
1002212393 5:177606761-177606783 GGCAGGGCGAGGGCAGAGGTGGG - Intronic
1003011157 6:2428670-2428692 GGCAGGTGGTGAGAAGAGTTTGG + Intergenic
1003166990 6:3688351-3688373 GGGAGGTGGTGGGCAGAGTTAGG + Intergenic
1005822672 6:29610645-29610667 GGCAGGGGGTGGGCAGAGGGCGG - Intronic
1006798345 6:36744643-36744665 GGGAGGGGAGGCTCAGAGTTGGG - Intronic
1008545057 6:52576916-52576938 GGCAGCGGGCGCGCAGCGGCCGG + Intergenic
1008602328 6:53108341-53108363 GGCAGGGGGCACGCAGGGCTAGG - Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1018840725 6:167514396-167514418 GGCTGGGGGCTGGCAGAGCTGGG + Intergenic
1019331201 7:461731-461753 GGCAGGCGGCGGGCAGAGACCGG - Intergenic
1019530384 7:1500130-1500152 GGCAGGAGGCGAGCAGCGCTGGG - Intronic
1019552014 7:1607890-1607912 GGCAGGGGTTGGGCAGGGTTTGG + Intergenic
1019557820 7:1641356-1641378 GGCAGGGGGCAGGCAGGGTGAGG - Intergenic
1019610737 7:1935485-1935507 GGCAGGGTGCGCCCAGACTCAGG + Intronic
1019712077 7:2522372-2522394 AGCAGGGGCCGCGCTGAGATGGG + Intronic
1019917817 7:4144698-4144720 GGCAGGGGGCAAGCAGCGTGGGG + Intronic
1020082898 7:5296209-5296231 AACAGAGGGCGCGCAGAGGTGGG - Intronic
1020262275 7:6537006-6537028 GGGAGGGGGCGGGCTGAGTCCGG + Intronic
1020282295 7:6655829-6655851 GGCAGGGGCCTTGCATAGTTGGG - Exonic
1021116868 7:16754149-16754171 GGCCGGGGGCGCGCAGACGTGGG - Intronic
1022653576 7:32298548-32298570 GGCAGGGGGAGCTCAGGGGTCGG - Intronic
1024043796 7:45574404-45574426 GGCGCGGGGCGGGCGGAGTTGGG - Intronic
1024059600 7:45687908-45687930 GGCAGGTGCAGCCCAGAGTTGGG + Intronic
1024961409 7:54980787-54980809 GGCAGAGGGAGCGCAGACATGGG + Intergenic
1025211370 7:57020979-57021001 AACAGAGGGCGCGCAGAGGTGGG + Intergenic
1025660583 7:63555868-63555890 AACAGAGGGCGCGCAGAGGTGGG - Intergenic
1026295924 7:69052356-69052378 GGCAGGTGGAGCCCAAAGTTTGG + Intergenic
1027145026 7:75688369-75688391 GGCCGGGGGCGCGCCGGGTCCGG + Intronic
1030361373 7:108598709-108598731 GGCAGGGGGTGCGGGGTGTTGGG + Intergenic
1032013425 7:128361047-128361069 GGCCGGGGGCTCACAGAGCTTGG - Intronic
1033048574 7:137983917-137983939 GGCAGGGAGCGGGCAGTGTGCGG - Intronic
1034273468 7:149814254-149814276 AGCTGGGGGGGTGCAGAGTTAGG + Intergenic
1035165754 7:156988844-156988866 TGCAGGGGGTGTTCAGAGTTCGG + Intergenic
1037587611 8:20288747-20288769 GGCAGGTTGGGCGCAGAGTTGGG - Intronic
1037902026 8:22694048-22694070 GGAGGGGTGCGCGCAGGGTTGGG + Intergenic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1038695940 8:29806216-29806238 GGCAGGGGGCTTCCACAGTTGGG - Intergenic
1039030075 8:33299438-33299460 GGCAGCGGGTGAGCAGGGTTGGG - Intergenic
1039210253 8:35205059-35205081 GGCAGGGGGCGGGAACAGGTGGG - Intergenic
1042306369 8:67337544-67337566 GGGAGGGGGTGGGCAGATTTGGG - Intronic
1044793515 8:95872485-95872507 GGCAGGGGGCTGGCAGGGGTGGG - Intergenic
1045389750 8:101703715-101703737 GGCAGATGGCGCTGAGAGTTTGG + Intronic
1046268849 8:111866375-111866397 GGCGGGGAGCGGGCAGAGGTTGG + Intergenic
1047993122 8:130307413-130307435 GGCAAGGGGCCCACAGATTTAGG + Intronic
1048259903 8:132936718-132936740 GGCAGGGGGTGAGCAGGGTGGGG - Intronic
1049574440 8:143383858-143383880 GGCAGGGGTCTCGCAGAGCTGGG - Exonic
1049845523 8:144799017-144799039 CGCAGTGGGCGCGCGGAGCTCGG + Intronic
1056225291 9:84489258-84489280 GGCATGGGGGGTGCAGAGGTAGG + Intergenic
1056929447 9:90862063-90862085 GGCAGCTGGAGGGCAGAGTTTGG - Intronic
1057227132 9:93298286-93298308 GGCAGGGGCTGCTCAGCGTTGGG + Intronic
1057623300 9:96655328-96655350 GGGGCGGGGCGCGCAGAGGTTGG + Intergenic
1057705512 9:97392378-97392400 GGAAGGAGGCGGGCAGAGCTGGG + Intergenic
1058967166 9:110048838-110048860 GGGAGCGGGCGCCCAGAGGTGGG + Exonic
1060247316 9:121957589-121957611 GGAAGGGGGCTACCAGAGTTGGG - Intronic
1061041824 9:128144987-128145009 GGCAGGAGGGGTGCAGAGCTGGG + Intergenic
1061058749 9:128239832-128239854 GGGAGGGGGCTCTCAGAGTCTGG - Intronic
1061400464 9:130365583-130365605 GGGAGGGGACGCACAGAGATGGG - Intronic
1203794482 EBV:169381-169403 GGCGCGGGGCGCGCAACGTTGGG + Intergenic
1187281470 X:17861005-17861027 CGCAGGGGGCGCGCCGGGCTGGG - Intronic
1187959859 X:24558169-24558191 GGCAGGGGGCGCGCAGAGTTGGG + Intronic
1189002132 X:36958221-36958243 GGCAGGGGACGCGGAGAGGTGGG - Intergenic
1189648255 X:43158055-43158077 GGCTGGGGGCAAGTAGAGTTGGG - Intergenic
1195654757 X:107323951-107323973 GGCAGGAGGGGTGCAGAGCTGGG + Intergenic
1198531368 X:137551693-137551715 GGCAGGGGGTGGGGAGAGTAGGG + Intergenic
1198542467 X:137654340-137654362 GGGAGAGGGGGTGCAGAGTTTGG + Intergenic