ID: 1187960453

View in Genome Browser
Species Human (GRCh38)
Location X:24562443-24562465
Sequence AGGGCTCTGCTTCGGGGATA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187960446_1187960453 1 Left 1187960446 X:24562419-24562441 CCGGCTCCGGGTTGGGCTGCTCA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG 0: 1
1: 0
2: 0
3: 6
4: 122
1187960449_1187960453 -5 Left 1187960449 X:24562425-24562447 CCGGGTTGGGCTGCTCACAGGGC 0: 1
1: 0
2: 1
3: 16
4: 190
Right 1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187960453 Original CRISPR AGGGCTCTGCTTCGGGGATA AGG Exonic
900403523 1:2482630-2482652 AGGGCTCTGCCCTGGGGACAGGG + Intronic
900929379 1:5726671-5726693 AGGGGTAGGCTTCGGGGTTAGGG - Intergenic
901209931 1:7518959-7518981 AGGGCTCTGCTCCTGGCACAGGG - Intronic
903743167 1:25570102-25570124 AGGGCTCTGCCTCTGGGTTCTGG - Intergenic
903848085 1:26290396-26290418 AGGGCTCTGCTTGAGGGAAGGGG - Intronic
904946033 1:34199489-34199511 GGGGCTGAGCTTCGGGGCTAAGG - Intronic
907560333 1:55381890-55381912 TGGGCCCTGCTTCTGGGAGAGGG + Intergenic
907872732 1:58457526-58457548 ATTGCTCTGCCTCGGGGTTAAGG - Intronic
912933397 1:113983265-113983287 AGGGCTGTGCTTTGGGGAGAAGG - Intergenic
917218040 1:172698259-172698281 AGGGCTCTGATTTGGGGACCAGG + Intergenic
919943914 1:202306527-202306549 GGTGCTCTGCTTCTGGGCTAGGG + Intronic
920010415 1:202862967-202862989 ACGCCTCTGGTTAGGGGATAAGG + Intergenic
924787385 1:247210855-247210877 AGGGCGCGGCTTCCGGGATCTGG - Intergenic
1062858000 10:789151-789173 AGAGCTCTGCTCCGGGGCCAGGG + Intergenic
1063185950 10:3651786-3651808 AAAGCTCTGCTTCAGGGAGAAGG + Intergenic
1063404131 10:5776362-5776384 AGGGCTGTGCTTCTGAGAAAGGG - Intronic
1067077393 10:43196021-43196043 AGGGCCCTGCTTTGGGGAGGGGG - Exonic
1067225046 10:44370460-44370482 AGTGGTCTGCTTAGGGGATTTGG + Intronic
1069695851 10:70384846-70384868 AAGGCTCTGCTTCTGGGAAGTGG + Intergenic
1069704117 10:70446886-70446908 GGGGCCCTGCTTTGGGAATATGG - Intronic
1074249745 10:111732633-111732655 AGGCCTGTGCTTCAGGGATTTGG + Intergenic
1074270513 10:111949148-111949170 ATGGCTCTGCTTCTGGGAGTTGG - Intergenic
1077338567 11:2016175-2016197 CCGGCTCTGCTTCTGGGATGAGG - Intergenic
1078180664 11:9007400-9007422 AGGCCTCTGCTCTAGGGATAGGG - Intergenic
1079104312 11:17560707-17560729 AGGGCTCATCTTCGAGGATGGGG + Exonic
1079837239 11:25350317-25350339 AGGGCTCTGCTTCCTGAAGAGGG + Intergenic
1084677812 11:70646521-70646543 ATGTCTCTGCTTAGGGGCTATGG + Intronic
1084954664 11:72684899-72684921 AGGGCTCTGCTTGGGGAAGGGGG + Intergenic
1088397106 11:109381345-109381367 AGGGCTCTTCTTCAGAGAAATGG - Intergenic
1090131030 11:124142211-124142233 AGGGCTCTGCTGGGGGGCGAGGG - Intronic
1202821551 11_KI270721v1_random:71357-71379 CCGGCTCTGCTTCTGGGATGAGG - Intergenic
1092261191 12:6954054-6954076 AGGGGTGTGCTTCGGGGAAAGGG + Intronic
1095960918 12:47833725-47833747 ACTGCTCTGATTCAGGGATAAGG - Intergenic
1096617500 12:52842191-52842213 AGGGCTCTGCTTGGGAGTCAAGG + Intronic
1104392567 12:128403298-128403320 AGGGCTCTCCTTGAGGCATATGG + Intronic
1113477227 13:110592756-110592778 TGGGTTCTGCTTAGGGGATGTGG - Intergenic
1114493545 14:23117975-23117997 ATCGCTCTGCTTCTGGGAGATGG + Intronic
1115783737 14:36801051-36801073 AGAGCTCTGCCTCAGGAATAGGG - Intronic
1117911457 14:60641909-60641931 AGGGCTGTGCGTGGGGGACAAGG + Intergenic
1122099262 14:99394290-99394312 AGGGCTCTGTTTGTGAGATATGG - Intergenic
1127328804 15:57919208-57919230 AGGGCTCTGGTTTGTGGTTAAGG - Intergenic
1127969416 15:63946800-63946822 AGGGCTGTGCTGTGGGGACAAGG + Intronic
1131869312 15:96745299-96745321 AGGGCTCAGCTCAGGGGAGAGGG - Intergenic
1132947161 16:2538027-2538049 GGGGCTCCGCTTCGGGGAGGAGG + Exonic
1133277941 16:4649240-4649262 AGGGCTCAGATTTGGGGGTAAGG + Intronic
1136002767 16:27307589-27307611 AGGGGAATGCTTCTGGGATAAGG - Intergenic
1139652711 16:68370682-68370704 AGGGCCCTGGCTCGGGGACAGGG - Intronic
1139788142 16:69410718-69410740 AATGCTCAGCTTCTGGGATAAGG - Intergenic
1141147928 16:81544842-81544864 AGGGCTCTGCTTCCGGTTTCTGG + Intronic
1147181772 17:38691019-38691041 AGGGCTGTGCTCAGGGGAAATGG + Intergenic
1147496694 17:40923214-40923236 TGGGCTCTGCTGCTGGGAAAAGG + Intronic
1152085999 17:78218971-78218993 AGGGCTTTGCTACAAGGATATGG - Intronic
1157762017 18:50272450-50272472 AGGACTCTCCTTTGGGGGTAGGG - Intronic
1159911047 18:74147205-74147227 AGGTATCTGCTTGGGGGATGAGG + Intronic
1160389182 18:78517642-78517664 AGGGCCCCGCTTCCGGGACAGGG - Intergenic
1160389196 18:78517683-78517705 AGGGCCCCGCTTCCGGGACAAGG - Intergenic
1160389209 18:78517724-78517746 AGGGCCCCGCTTCCGGGACAAGG - Intergenic
1160389222 18:78517765-78517787 AGGGCCCCGCTTCCGGGACAAGG - Intergenic
1160791126 19:924227-924249 AGGCCTCTCCATCGGAGATAGGG + Intergenic
1160897581 19:1409881-1409903 AGGGCTCTGCATCAGGAAGAGGG - Intronic
1163767113 19:19169957-19169979 AGGGCTCTGCGTCTGAGATTTGG - Intronic
1168465100 19:56595393-56595415 AGGGCGCGGCCTCGGGGAGACGG + Exonic
927104633 2:19812644-19812666 AGTGCTCTGCTTCTGGGTTAGGG - Intergenic
930095187 2:47561221-47561243 AGGGCTCTGCTCCGGGTGTGGGG + Intronic
932565086 2:72901118-72901140 AGGGCACTGCTTAGGGGAGGTGG + Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
936574490 2:113641901-113641923 ACGGCTCCTCTTCAGGGATAGGG + Intronic
936733109 2:115407421-115407443 AGGGGGCTGCTTTGGGGAAATGG + Intronic
936987530 2:118325687-118325709 AGGGCACTGCTTGGGGTATGAGG + Intergenic
945411835 2:209519013-209519035 AGGGCTCTACTACAGGGAGACGG + Intronic
946101484 2:217328528-217328550 AGGGATCTGCTTTAGGGCTAAGG - Intronic
946485797 2:220099523-220099545 AGGGCTGTGCTTCTGGCATTTGG + Intergenic
1170300749 20:14881765-14881787 AGGGCCCTGGTTCTGGGAAAAGG - Intronic
1170574522 20:17652515-17652537 AGGGCTGTGCTGCGGGGATCTGG - Intronic
1172128390 20:32639084-32639106 AGGGCTCTGCATCCTGGGTAGGG - Intergenic
1172443731 20:34982373-34982395 AGGGCTCTGCTTGAGGGGTGAGG + Intronic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1172818639 20:37711876-37711898 AGGGGTCAGCTTCGGGGAGGAGG + Intronic
1172869901 20:38129542-38129564 TGGGCGCTGCTTCCAGGATAAGG - Exonic
1173596079 20:44259047-44259069 AGGGCTGTGCTTCGTGGCCAAGG + Intronic
1175808572 20:61845219-61845241 TGGGCTGTGCTTCGGAGAAAGGG - Intronic
1181031067 22:20149116-20149138 AGGGCCCTGCTTGGGCGAGAGGG - Intronic
1182550960 22:31100515-31100537 AGGGCTGTGCCCCGGGGAGAGGG - Intronic
1182842431 22:33402241-33402263 GGGCCTCTGGTTCTGGGATATGG - Intronic
1183659180 22:39208324-39208346 AGGGCTCTGATGAGGGGATGAGG + Intergenic
1184449556 22:44574872-44574894 AGGGCTCTGTCTTGGGGAGAGGG - Intergenic
1185119057 22:48954924-48954946 AGGGCCCAGCTTGGGGGATGAGG - Intergenic
1185425680 22:50768982-50769004 ACGGCTCCTCTTCAGGGATAGGG - Intronic
1185430492 22:50807862-50807884 CGGGTTCTGTTTCGGGGTTAGGG + Intergenic
953328568 3:42033240-42033262 AGAGCTCTGGTGTGGGGATAAGG + Intronic
966907537 3:184538741-184538763 AGTGCTGTGCTCCTGGGATAAGG - Intronic
967328392 3:188265579-188265601 AGGGCTTTGCTGTGGGGATTGGG + Intronic
968138777 3:196238832-196238854 GGGGCTCTGCTTCGGGCTGATGG + Exonic
968873760 4:3254669-3254691 AGAGCTCTGCTGCTGGGGTAGGG - Intronic
982087230 4:151848203-151848225 AGGGCTTGGCTTTGGGGAGAGGG - Intergenic
985693937 5:1329416-1329438 AGGCCTCTGCTTGGTGGACAGGG + Intronic
990151445 5:52822535-52822557 ACTGCTCTGCATAGGGGATATGG + Intronic
992977100 5:82131859-82131881 TGGCATCTGCTTCTGGGATAGGG + Intronic
993960924 5:94296023-94296045 AAGCCTCTGCTTCAGGGAGATGG + Intronic
999124116 5:149234009-149234031 AGTGCTCTGCTCTGGGGAAATGG + Intronic
1002212410 5:177606826-177606848 AGGGCTCTGCATAGGAGAGATGG - Intronic
1006800014 6:36753704-36753726 AGGCCTCTGCTTGGGGGAGGGGG - Intronic
1007233801 6:40375745-40375767 AGGGCTCTGCCTCGTGAATTTGG - Intergenic
1007788642 6:44296771-44296793 AGGGCTCTCCTGAGGGGATCTGG - Intronic
1013003348 6:106046702-106046724 AGGGCTCTGCGCTGGGGAGAGGG + Intergenic
1018754466 6:166837412-166837434 AAGGCCCTGCTTCGGGGAAGAGG - Intronic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1022056983 7:26747350-26747372 AGGGTTATGCTTTGGGGAAAAGG + Intronic
1024087076 7:45902495-45902517 AGGGCTCTGGACTGGGGATAGGG - Intergenic
1024889690 7:54185750-54185772 AGGGCTCTGCTTTCGTGATGAGG + Intergenic
1030614854 7:111728715-111728737 AGAGCCCTGCTCCGGGGAGAAGG + Exonic
1033411413 7:141121386-141121408 AGGGCTCTGCAAAGGGGAAACGG - Intronic
1039355233 8:36808181-36808203 AGGGCTCTCCTTAGGTGACAAGG + Intronic
1039704141 8:39989881-39989903 TGGGCTCTGCTTAGGGGAAGAGG + Intronic
1048628748 8:136217092-136217114 AGGTGTTTGCTTAGGGGATATGG - Intergenic
1048928348 8:139290959-139290981 AGGGCTCTGTTCCAGGGCTACGG - Intergenic
1049593151 8:143471658-143471680 AGGGCTCGGCTTCAGGGACTGGG + Intronic
1049977775 9:876258-876280 AGGGAGCTGCTTCCAGGATAAGG + Intronic
1053509368 9:38674202-38674224 AGAGCCATGCTTCGGGCATAAGG + Intergenic
1057334369 9:94144204-94144226 TGGGCTCTGCTCCTGGGATCCGG + Intergenic
1058699457 9:107588596-107588618 AGGGTGCTGCTTCGGGCATTTGG - Intergenic
1060413615 9:123415734-123415756 AGGGCCCTGCTGCAGGGATGCGG + Intronic
1060699521 9:125738698-125738720 AGAGCTCTGCATCTGGGATCAGG - Intergenic
1060722379 9:125987586-125987608 AGGGCTCTGTGTCGGGGGGAAGG + Intergenic
1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG + Exonic
1197062382 X:122196355-122196377 AGGGCACTGTTTTGGGGAAACGG - Intergenic
1197685480 X:129435426-129435448 AGGCTTCTGCTTCAGGGCTAGGG - Intergenic
1201783074 Y:17744421-17744443 AGGGCTCTGTCTCTGGGATAAGG - Intergenic
1201818479 Y:18161566-18161588 AGGGCTCTGTCTCTGGGATAAGG + Intergenic