ID: 1187970296

View in Genome Browser
Species Human (GRCh38)
Location X:24652106-24652128
Sequence AAGGCATGCTCTTCTTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187970296_1187970298 16 Left 1187970296 X:24652106-24652128 CCTCTACAAGAAGAGCATGCCTT No data
Right 1187970298 X:24652145-24652167 GATCAGTGCTGTCCCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187970296 Original CRISPR AAGGCATGCTCTTCTTGTAG AGG (reversed) Intronic