ID: 1187973275

View in Genome Browser
Species Human (GRCh38)
Location X:24679949-24679971
Sequence ATGGAGAAGAGGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187973275_1187973280 -6 Left 1187973275 X:24679949-24679971 CCTTCCCCTTTCCTCTTCTCCAT No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187973275 Original CRISPR ATGGAGAAGAGGAAAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr