ID: 1187973280

View in Genome Browser
Species Human (GRCh38)
Location X:24679966-24679988
Sequence CTCCATTCTCCCATCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187973273_1187973280 -2 Left 1187973273 X:24679945-24679967 CCCACCTTCCCCTTTCCTCTTCT No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973270_1187973280 16 Left 1187973270 X:24679927-24679949 CCTAACCCATTGTATCTTCCCAC No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973276_1187973280 -10 Left 1187973276 X:24679953-24679975 CCCCTTTCCTCTTCTCCATTCTC No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973269_1187973280 24 Left 1187973269 X:24679919-24679941 CCTGAGAGCCTAACCCATTGTAT No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973272_1187973280 10 Left 1187973272 X:24679933-24679955 CCATTGTATCTTCCCACCTTCCC No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973271_1187973280 11 Left 1187973271 X:24679932-24679954 CCCATTGTATCTTCCCACCTTCC No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973275_1187973280 -6 Left 1187973275 X:24679949-24679971 CCTTCCCCTTTCCTCTTCTCCAT No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data
1187973274_1187973280 -3 Left 1187973274 X:24679946-24679968 CCACCTTCCCCTTTCCTCTTCTC No data
Right 1187973280 X:24679966-24679988 CTCCATTCTCCCATCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187973280 Original CRISPR CTCCATTCTCCCATCTACCA AGG Intergenic
No off target data available for this crispr