ID: 1187976988

View in Genome Browser
Species Human (GRCh38)
Location X:24712759-24712781
Sequence GATCCATTTGGTGTTTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187976988 Original CRISPR GATCCATTTGGTGTTTATAC TGG Intronic
900774353 1:4570849-4570871 GGTCCCTTTGGTGTTTGTCCAGG - Intergenic
904297584 1:29531469-29531491 GAACCATTTGGAATTTTTACAGG - Intergenic
906664598 1:47610927-47610949 GATCCATTTGGAAGTTATCCTGG - Intergenic
908854908 1:68415864-68415886 GACCCATGTGGGGTTTATTCAGG - Intergenic
909084692 1:71156493-71156515 GTTCAATTTGGTGTTTCTGCAGG + Intergenic
909442487 1:75713466-75713488 GATCCATTTTAAGTTTATTCTGG + Intergenic
909514151 1:76488539-76488561 GATCCATGCTGTATTTATACAGG + Intronic
911797593 1:102094167-102094189 AATCCAGCTGGTGTTTATAATGG - Intergenic
912571326 1:110625446-110625468 AGTCTATTTGGAGTTTATACTGG - Intronic
915387573 1:155509883-155509905 GATCCATTTGGAGTTTGTTATGG - Intronic
916732795 1:167581366-167581388 GATCCATTTGGTGGGGATCCGGG + Intergenic
917652507 1:177092652-177092674 GATCCATTTGGGGTTCATTTTGG + Intronic
918464597 1:184808442-184808464 CATCCAGTTGGTGTTTCTGCTGG - Intronic
918621247 1:186608491-186608513 TATCCATTAGGTTTTTGTACAGG + Intergenic
921649167 1:217656390-217656412 GAATCATTTGGTGATTATACTGG - Intronic
924376463 1:243414365-243414387 TATCCATTTGTTGTATATACTGG + Intronic
1065093744 10:22261283-22261305 GATCCAGGTGCTGGTTATACAGG - Intergenic
1065618169 10:27550309-27550331 GAACCCTTTGCTGTTTAGACAGG + Intergenic
1065969718 10:30796683-30796705 GACCCATCTGGTTTTTATATGGG - Intergenic
1067775182 10:49158829-49158851 GATCCATTTGTCATTTATTCTGG - Intronic
1072114236 10:92354358-92354380 CATCCATTTGGGGATTATATTGG + Intergenic
1074136887 10:110635775-110635797 GATTCATTTGGAGTTCATTCTGG - Intergenic
1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG + Intronic
1079147316 11:17864991-17865013 GATCCATATGGAATTTATCCTGG - Intronic
1079723327 11:23846805-23846827 GTTCAATTTGGTGTTTCTGCAGG + Intergenic
1079830187 11:25255784-25255806 GCTCCATGGAGTGTTTATACTGG - Intergenic
1080794281 11:35549127-35549149 AATGCATTTGGGCTTTATACTGG - Intergenic
1082583061 11:54897621-54897643 GATCCTTCTGGTTTTTATCCTGG - Intergenic
1085561440 11:77475421-77475443 AATCCTTTCGGTGTTTAAACGGG - Intergenic
1090031994 11:123214994-123215016 GATTCATTTGGAGTTTATTCTGG + Intergenic
1091080192 11:132659212-132659234 GATCCATTAGGTCTTCATAAGGG - Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1092139659 12:6174313-6174335 GATCCATTTGGAACTTATTCTGG - Intergenic
1094762349 12:33548767-33548789 TATCTATGTGGTGTATATACTGG + Intergenic
1096347063 12:50858416-50858438 AATCCATTTGGAGTTTATTTTGG + Intronic
1097865715 12:64557654-64557676 GATCCATTTATTCTTTCTACGGG + Intergenic
1099397133 12:82154351-82154373 GTTCCATTTGGAATTTATTCTGG - Intergenic
1101155541 12:101924315-101924337 GATCCATTTGGACTTTATAAAGG + Intronic
1105851783 13:24341494-24341516 AATACATTTAGTGTTTATAAAGG + Intergenic
1109082584 13:57924301-57924323 GATTCCTTTGGTCTTAATACTGG + Intergenic
1110423410 13:75338675-75338697 GATACATTTGGTGCCTATAGAGG - Intronic
1110884183 13:80612502-80612524 CATCCATTTGGTGTTTAGTCTGG + Intergenic
1111335433 13:86815550-86815572 GTTCGATTTGGTGTTCCTACGGG - Intergenic
1113000451 13:105629977-105629999 GGTCCATTTGCAGTTTATAGGGG - Intergenic
1113978874 13:114254849-114254871 GGTCCATTTGATGTTAATGCTGG - Intronic
1114508274 14:23234468-23234490 GATCCATTTGAAATTTATCCTGG + Intronic
1121161306 14:91743937-91743959 GATCCATTTGATTTTGATGCTGG + Intronic
1121701485 14:95957889-95957911 CATCCAGGTTGTGTTTATACTGG + Intergenic
1125304705 15:38297392-38297414 GATGCATATTGTGTTTATAGTGG + Intronic
1125925142 15:43557061-43557083 GATCCATATGGAGTTTATCCTGG + Intronic
1126553530 15:49960537-49960559 GATTCATTTGGATTTTATCCTGG - Intronic
1126917878 15:53485864-53485886 GATGCATTTGGAGTTTGTACTGG + Intergenic
1131201899 15:90405080-90405102 GATCCATTTGGAATTTATTTTGG + Intronic
1134516469 16:14891580-14891602 TATCCATTTGGAGTTTTTCCTGG + Intronic
1134704142 16:16290231-16290253 TATCCATTTGGAGTTTTTCCTGG + Intronic
1134963401 16:18421883-18421905 TATCCATTTGGAGTTTTTCCTGG - Intronic
1134967696 16:18504482-18504504 TATCCATTTGGAGTTTTTCCTGG - Intronic
1136359172 16:29766787-29766809 GCTCCAATTGGCGTTTATAGGGG + Intergenic
1138255206 16:55551562-55551584 AATCTATTTGGTCTTCATACAGG - Intronic
1138367231 16:56490227-56490249 GTTCCAGTTGGAGTTTATCCTGG - Intronic
1138806954 16:60101103-60101125 GTTCAATTTGGTGTTCCTACAGG + Intergenic
1140248652 16:73274501-73274523 GATCCATTTGGAATTTATTTGGG + Intergenic
1143791917 17:9303779-9303801 GATCCATTTGGAGTTTATCCTGG - Intronic
1145117604 17:20225782-20225804 GTTCCATTTGGTGTTCCTGCAGG + Intronic
1146152498 17:30487300-30487322 GATCCATTTGGAATTTGTTCTGG - Intronic
1149906792 17:60533940-60533962 GATCCTTCTGGTTTTTATAGAGG - Intergenic
1151297688 17:73197584-73197606 TATCCATTTAGTGTCTATATTGG + Intronic
1152311407 17:79552672-79552694 GCTCCATTTGGAGTTTATCGAGG + Intergenic
1152936621 17:83141411-83141433 AATCCATTTTGTGTTGATTCTGG - Intergenic
1153183445 18:2460952-2460974 GTTCAATTTGGTGTTTCTGCAGG + Intergenic
1157571562 18:48715771-48715793 CATGCCTTTGGTGTTGATACTGG + Intronic
1158116719 18:54004457-54004479 GTTCAATTTGGTGTTTCTGCAGG - Intergenic
1160066076 18:75575515-75575537 GATCCATCAGGTTTTTTTACTGG - Intergenic
930214190 2:48676871-48676893 GATTCATTTGGTGTTTGTCTTGG + Intronic
931928526 2:67102264-67102286 GATCCATTTGGCATTTATTTTGG + Intergenic
933966368 2:87432616-87432638 GCTCCATCTGATGTTTATTCTGG - Intergenic
935919031 2:107989505-107989527 GACTCATTTGGTCTTTATAACGG + Intronic
935989230 2:108704559-108704581 GTTCCATTTGGTGTTCCTGCAGG - Intergenic
936327427 2:111517869-111517891 GCTCCATCTGATGTTTATTCTGG + Intergenic
939897929 2:147814617-147814639 GATTCATTTGAAATTTATACTGG - Intergenic
940688027 2:156878678-156878700 GATCCATTTTTTATTTAGACAGG - Intergenic
942287150 2:174430780-174430802 GATCCCTTTGGTATTTAAAGAGG - Intergenic
944200600 2:197103383-197103405 GATCCTTTTGGAGTTTATCTTGG + Intronic
945927706 2:215822514-215822536 GATCCATTTGTTTTTTAGAAGGG - Intergenic
947400028 2:229722581-229722603 GATCCACTTGGAGTTTATTGAGG - Intergenic
1169811069 20:9609807-9609829 GATCCATTTGAATTTTAAACAGG - Intronic
1173384141 20:42572784-42572806 GCTCCAGGTGGTGTTTACACAGG - Intronic
1174241495 20:49139078-49139100 GATCCATTTTGAGTTTTTAGTGG - Intronic
1175092506 20:56516521-56516543 GATTTAGTTGGTGTTTATGCTGG + Intronic
1176092269 20:63323888-63323910 AATTCAGTTGGTGTTTTTACTGG + Intronic
1177869378 21:26552430-26552452 AATCCATTTGCTGTTTTTACTGG + Intronic
950878699 3:16303375-16303397 GCTTAATTTGGTGTTTATTCTGG + Intronic
955198341 3:56826960-56826982 GATGTATTTGGTGCTTATCCTGG - Intronic
955459576 3:59166376-59166398 GATCAATTTGGAGTTTATTCTGG - Intergenic
955562778 3:60210291-60210313 GATCCATTTGGAATTTATCCTGG - Intronic
955585357 3:60471731-60471753 GTTCAATTTGGTGTTTCTGCCGG + Intronic
956026751 3:64991123-64991145 GAGCCCTTTGTTGGTTATACAGG - Intergenic
957264933 3:77950898-77950920 GTTCCATTTTGTGTTTATATAGG - Intergenic
958737084 3:98021792-98021814 CATCTATTTGGTTTTTATGCAGG + Intronic
960132068 3:114067965-114067987 GTTCTTTTTTGTGTTTATACAGG + Exonic
960265971 3:115621534-115621556 GCACCTTTTGGTGTTTAAACAGG - Intergenic
960483514 3:118222955-118222977 GAGCCAATTGGGGTTTAAACTGG + Intergenic
961516109 3:127437830-127437852 GAACCACTTGGTGACTATACGGG + Intergenic
963331925 3:143924275-143924297 GATCCATTTGTTTTTTGCACAGG + Intergenic
964656235 3:159068963-159068985 GATCCATTTGAAGTTTGTAAAGG + Intronic
965372317 3:167878521-167878543 GATCCATTGGGAATTTATCCTGG + Intergenic
966965521 3:184988318-184988340 GATCCATTTTGTGTTAATTTTGG + Intronic
968933432 4:3596860-3596882 GATCCATTTGGAGTTGACTCTGG + Intergenic
970698389 4:18705374-18705396 GAGCCAGTTAGGGTTTATACAGG - Intergenic
972808649 4:42558712-42558734 GATCCATCTGGAGTTTATTTTGG - Intronic
973239901 4:47946216-47946238 GATCCATTTGGTTTTTGCAGGGG - Intronic
976157801 4:82166617-82166639 GATCCATTTGGTTTTGGTAGGGG + Intergenic
976284289 4:83356100-83356122 GATCCATTTGGTGGAGATCCAGG + Intergenic
977341414 4:95763543-95763565 GTTCAATTTGATGTTCATACAGG - Intergenic
977851160 4:101831339-101831361 GAACCATTTGGGGTTGATATAGG - Intronic
979750038 4:124267982-124268004 GTTCCTGTTGGTGATTATACTGG + Intergenic
980312920 4:131157928-131157950 GATGTATTTTGTGATTATACTGG + Intergenic
982185789 4:152797125-152797147 AATCCATTTGGAGTTTATTCTGG + Intronic
983810065 4:172050609-172050631 GACCCATTTGGTGTGGATCCAGG + Intronic
985623951 5:974556-974578 GATTCATTTGGATTTTCTACTGG - Intergenic
985982543 5:3482975-3482997 GATGCTTTTAGTGTTTATCCAGG - Intergenic
986756187 5:10838896-10838918 GTTCAATTTGGTGTTCCTACAGG - Intergenic
986928264 5:12785443-12785465 GATCCATTTGGGATTTATCTGGG + Intergenic
990274305 5:54179189-54179211 GATCCATTCTGTGTTGATAGAGG + Intronic
990563121 5:57003505-57003527 ATTCCATTTGGTTTTTATACTGG + Intergenic
991211923 5:64115919-64115941 CATCCCTTTGGTGTTTCTACTGG - Intergenic
994654278 5:102570332-102570354 GTTTAATTTGGTGTTTTTACTGG + Intergenic
996282093 5:121742272-121742294 GTTCTATTTAGTGTTTATCCTGG + Intergenic
997660824 5:135588406-135588428 GCTCAACTTGGTGTTTATAGAGG - Intergenic
997754057 5:136377986-136378008 GATTCATTTGGAGTTTGTTCTGG - Intronic
998069722 5:139187721-139187743 GATACATTTGGAATTTATTCAGG + Intronic
998842079 5:146264952-146264974 GATCCATTTGGAATTTATACTGG - Intronic
999689128 5:154130545-154130567 GATCCATTTGGGATTTATCTTGG - Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1004948199 6:20638537-20638559 AGTCCATTTGGTGTTTATATAGG + Intronic
1005038341 6:21578303-21578325 CTTCCTTTTGGTGTTTATATAGG + Intergenic
1007034550 6:38661268-38661290 GATCGACTTGGTGTTTATGTAGG - Intergenic
1007301361 6:40870310-40870332 GATCCATTTGGTGGGGATCCAGG + Intergenic
1009935317 6:70227156-70227178 GATCCATTTGTATTTTATCCTGG - Intronic
1011417629 6:87139189-87139211 GAACCACTTGGAGTTGATACTGG + Intergenic
1011694129 6:89896838-89896860 TATCCATTTCATGTTTATAATGG - Intergenic
1012482958 6:99688887-99688909 GTTCTATTTGGTGCTTCTACAGG - Intergenic
1012990028 6:105916039-105916061 TATCCATTTGGTTTTTTTCCTGG + Intergenic
1015140439 6:129925178-129925200 GATCCATCTGGAATTTATTCTGG + Intergenic
1023426293 7:40040196-40040218 GATTCATTTGCTTTTTATGCTGG + Intronic
1024696536 7:51862507-51862529 AATCCATTAGGTGTTTAAATAGG - Intergenic
1024764135 7:52636605-52636627 GTTTCATTTGGTGTTTCTGCAGG + Intergenic
1025061515 7:55812630-55812652 GTTCAATTTGGTGTTTATGTAGG - Intronic
1025528953 7:61852212-61852234 ATTCCACTTAGTGTTTATACTGG + Intergenic
1025595524 7:62919751-62919773 TTTCCATCTGGTTTTTATACTGG - Intergenic
1025948683 7:66125531-66125553 GAACCAATTGATGTTTACACAGG - Intronic
1026264012 7:68780681-68780703 GATCTATCTGGAGTTTATTCTGG - Intergenic
1027405544 7:77855998-77856020 GTTCAATTTGGTGTTTCTTCTGG + Intronic
1030662600 7:112238038-112238060 GTTCAATTTGGTGTTTGTATAGG - Intronic
1033380543 7:140812868-140812890 GATCCATTTGTAGTTTATTCTGG - Intronic
1033599618 7:142879442-142879464 GAGCCATTTGGTCTTTCTATGGG + Intronic
1035346784 7:158205559-158205581 GTTCAATTTGGTGTTCCTACAGG - Intronic
1036807584 8:11846095-11846117 GATTCATCTGTTCTTTATACTGG + Intronic
1037698558 8:21250520-21250542 TATCCATTTGGAGCTTATATTGG - Intergenic
1039601752 8:38844882-38844904 AATACATTTGGAGTTTATCCTGG + Intronic
1040991509 8:53356092-53356114 GATCCATTTGAAATTTATTCTGG - Intergenic
1042177771 8:66054425-66054447 GATCCAATTGGAGTTTATTTTGG + Intronic
1043407113 8:79948327-79948349 TATACATTTGTTTTTTATACTGG + Intronic
1045204714 8:100026221-100026243 GATCCAAATGATGTTCATACTGG - Intronic
1050291535 9:4160386-4160408 GATCCTTTTGGAATTTTTACTGG - Intronic
1051378554 9:16431274-16431296 GTTGCATTTGGTTTTTATTCAGG - Intronic
1052097889 9:24406977-24406999 TATTCATTTTGTTTTTATACTGG + Intergenic
1053023692 9:34713679-34713701 TATCCATTTGGAGTTTATTATGG + Intergenic
1054456711 9:65434957-65434979 GATCCACTTGGAGTTTACTCTGG - Intergenic
1055551123 9:77433074-77433096 GCTTCCTTTGGTGTTTATCCCGG - Intronic
1056887524 9:90457620-90457642 GAGCCATTGGGTGTTTTGACAGG - Intergenic
1060016499 9:120091079-120091101 AATTCATTTGGTCTTTATAAAGG - Intergenic
1186257108 X:7733662-7733684 GAGCCATTTGATGTTTAAAGAGG + Intergenic
1186964681 X:14774539-14774561 GATCCATTTGGAGTTGATGTTGG - Intergenic
1187976988 X:24712759-24712781 GATCCATTTGGTGTTTATACTGG + Intronic
1189786469 X:44563257-44563279 GAGCCATTTGGAGTTCATTCTGG - Intergenic
1189819394 X:44855809-44855831 GATCCATTTGGAATATATCCTGG + Intergenic
1191178320 X:57531003-57531025 GATCTATCTGTTGTTTAAACTGG + Intergenic
1192073805 X:67969414-67969436 GATCCATCTTGTGTTTAAAAAGG - Intergenic
1195382924 X:104288144-104288166 AATCCATCTGGTGTTTATTTTGG + Intergenic
1196234628 X:113263543-113263565 GTTCAATTTGGTGTTCCTACGGG + Intergenic
1196331675 X:114477874-114477896 GATCTATTTGGAATTTATCCTGG - Intergenic
1196498858 X:116353590-116353612 GATCCATTTGGTATTTATTTTGG + Intergenic
1197613013 X:128659714-128659736 GATTCCTTTGGTGTGTATGCTGG + Intergenic
1198748557 X:139915704-139915726 ACTTCATTTGGTATTTATACTGG + Intronic
1199451641 X:147983882-147983904 GATCCATTTGGAGTTGATTTTGG + Intronic
1200392934 X:155962812-155962834 AATAAATTCGGTGTTTATACTGG - Intergenic
1201434437 Y:13941374-13941396 AATCTATTAGATGTTTATACTGG + Intergenic