ID: 1187977885

View in Genome Browser
Species Human (GRCh38)
Location X:24722082-24722104
Sequence ACTCCTTTTTTCACACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187977885_1187977887 4 Left 1187977885 X:24722082-24722104 CCAGGATGTGTGAAAAAAGGAGT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1187977887 X:24722109-24722131 GATGAGTAGTCTTTCAAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1187977885_1187977888 5 Left 1187977885 X:24722082-24722104 CCAGGATGTGTGAAAAAAGGAGT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1187977888 X:24722110-24722132 ATGAGTAGTCTTTCAAACTGGGG 0: 1
1: 0
2: 0
3: 19
4: 140
1187977885_1187977886 3 Left 1187977885 X:24722082-24722104 CCAGGATGTGTGAAAAAAGGAGT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1187977886 X:24722108-24722130 TGATGAGTAGTCTTTCAAACTGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187977885 Original CRISPR ACTCCTTTTTTCACACATCC TGG (reversed) Intronic
900509672 1:3052620-3052642 ACTCCTTCTCCCACACACCCTGG - Intergenic
901491886 1:9600991-9601013 ACCCATGTTCTCACACATCCTGG - Intronic
902802980 1:18841880-18841902 AGTCCTCTTTTCCCACATTCTGG + Intronic
904018820 1:27445710-27445732 ACTCCTGTTTTCAAACAGCTAGG + Intronic
906617536 1:47244101-47244123 AATCCTGTTTTCCCACTTCCTGG - Intergenic
909522553 1:76586508-76586530 ACTCCTATTATCACTCATTCTGG + Intronic
912570882 1:110620164-110620186 ACCCCTGTCCTCACACATCCCGG + Intronic
912859532 1:113200862-113200884 ACTGCTTTTTTCACAAATTGAGG + Intergenic
912907016 1:113718253-113718275 ACTCCAGGTCTCACACATCCAGG + Intronic
913321375 1:117591017-117591039 TCTCCATTTTTAAGACATCCAGG - Intergenic
918700795 1:187604029-187604051 TTTCCTTTTTTCACATTTCCTGG - Intergenic
920157281 1:203964364-203964386 ACTCCTCTTATCCCACATCATGG - Intergenic
920173514 1:204086047-204086069 ACTCATACTTTCACACCTCCGGG - Intronic
920386828 1:205575517-205575539 CCTCCTCTTTTCACAGAACCAGG + Intronic
921315946 1:213890713-213890735 ACTTGTATTTTCACATATCCTGG + Intergenic
921427310 1:215019367-215019389 ACTCCTTTTTACATACAAACAGG - Intronic
922076312 1:222248179-222248201 ACTCCTCTTTTCATCCTTCCAGG + Intergenic
923885585 1:238151574-238151596 ACTCCTTTTATCACTTCTCCTGG - Intergenic
924192993 1:241575040-241575062 ACACCTTTTTGCATACATACTGG - Intronic
924398837 1:243655498-243655520 ACTCATTTTTTAACAAGTCCTGG + Intronic
1063714030 10:8509557-8509579 ACTCTTTCTTTCACACAGACAGG - Intergenic
1064699605 10:18005532-18005554 ACTCTGTTTTTCACACAGACTGG + Intronic
1066321831 10:34310373-34310395 ATTCCATTTTCCACACAGCCTGG + Intronic
1066721212 10:38341808-38341830 ACTCATTTTTTCACAGTTCTGGG + Intergenic
1067182626 10:44000456-44000478 TCTCCTTTTTTCTCACCTGCAGG - Intergenic
1067182754 10:44002106-44002128 ACTCCTTTTTTCACTCTTTATGG - Intergenic
1067232097 10:44419144-44419166 TGTCCTTTTTTCCCACAGCCTGG + Intergenic
1068746188 10:60533205-60533227 ACTCCTTCATTTACACAACCAGG - Intronic
1068797897 10:61104454-61104476 CTTCCTTTTTTCACACATCATGG - Intergenic
1072449161 10:95525764-95525786 ACATCTTTTTTCACATATGCAGG + Intronic
1072692294 10:97579959-97579981 ACTGCCTCTTTCACACTTCCCGG + Intronic
1073576508 10:104630672-104630694 ACTCCTCTTTCCACAGGTCCGGG - Intergenic
1081058045 11:38435202-38435224 ACTTATTTTTTCAAACCTCCAGG - Intergenic
1081819573 11:45978638-45978660 ACTCATTTTTGCACACTTCAAGG - Intronic
1083353151 11:62045496-62045518 CTTCCTTTCTTCCCACATCCAGG - Intergenic
1091279095 11:134371838-134371860 ACTCTTCTTTTGACACATTCTGG - Intronic
1091751096 12:3021666-3021688 ACTCCTTTTGTTTTACATCCTGG - Intronic
1092265109 12:6974882-6974904 ACTCCCTCTTTCACTCAGCCAGG - Intronic
1093199342 12:16168418-16168440 ATTGCTGTATTCACACATCCTGG + Intergenic
1093323914 12:17749208-17749230 ACTCCCTTCCTCACACATCATGG - Intergenic
1094092741 12:26669482-26669504 ACTCCTTTGTAAACACATCATGG + Intronic
1094614603 12:32024876-32024898 ACTTCTTTTTTTGCCCATCCTGG + Intergenic
1097405335 12:59182408-59182430 ACTCATTTATTCAGACATCCAGG - Intergenic
1098565322 12:71928652-71928674 ATTCCTTCTTTCGCACATCAAGG + Intergenic
1098802066 12:74973166-74973188 ACTCGTTTTATGACAGATCCAGG + Intergenic
1102173191 12:110857705-110857727 CCCCCTGTTTTCCCACATCCCGG + Intronic
1107280254 13:38725488-38725510 AATTCTTTTTTCACTCATCAGGG - Intronic
1107890388 13:44909361-44909383 ACTCCATTTTTCACAAGTCTTGG - Intergenic
1110943523 13:81383826-81383848 ACTCCTTTCTGCATAAATCCTGG + Intergenic
1111367364 13:87267394-87267416 GCTGCTTTTTTGACACATCTTGG - Intergenic
1112790213 13:102995021-102995043 ATTCCATGTCTCACACATCCAGG + Intergenic
1116780137 14:49227974-49227996 TCTCTTTTTCTCTCACATCCAGG + Intergenic
1120235423 14:81885035-81885057 ACTCCTCTTTTCTCTCATACTGG - Intergenic
1121929926 14:97963206-97963228 GCTCCTTCTATCACAAATCCAGG + Intronic
1124706234 15:31967849-31967871 ACTCCTTTTCTCACACATTAAGG + Intergenic
1126329840 15:47520463-47520485 ACGCCTTTTTACTCACATCTTGG + Intronic
1126866812 15:52945703-52945725 ACTCCTCTTTTCCCAGGTCCAGG + Intergenic
1127012839 15:54649285-54649307 ACTCCATGTCTCTCACATCCAGG + Intergenic
1127463498 15:59221754-59221776 ACTTCTTGTTTCAAACATCTAGG + Intronic
1128859113 15:71050619-71050641 AGTCCTGTTTTCCCATATCCTGG - Intronic
1130719916 15:86376538-86376560 ACACCTGTTATCACACATCATGG - Intronic
1135691870 16:24544609-24544631 TCTCCTTTAATCACACAACCAGG - Intronic
1135759823 16:25128453-25128475 CCTCCTTTTTTCTCCCTTCCAGG + Exonic
1135838156 16:25847030-25847052 ACTCTTTTTTTCACATTTACAGG + Intronic
1145203477 17:20967685-20967707 CCTCCTGTTTTCACACCCCCAGG - Intergenic
1147999320 17:44378553-44378575 TCCCCTCTTTTCCCACATCCTGG - Intronic
1148550851 17:48550244-48550266 GCTCCTCTTTTCAGACCTCCAGG + Exonic
1149188988 17:54035544-54035566 ACTCCTTTTTTCATATATTCAGG + Intergenic
1150579719 17:66461174-66461196 TCTCATTTTTTCACCCAGCCTGG - Intronic
1152171446 17:78752130-78752152 AGTCCTTATTTCAAACATCTAGG - Intronic
1152417847 17:80174664-80174686 ATTTCTTTAATCACACATCCAGG - Intronic
1155009737 18:21764915-21764937 ACTACTTTATAAACACATCCTGG - Intronic
1155842825 18:30667801-30667823 ACTCCATGTCTCACATATCCAGG + Intergenic
1156205040 18:34876177-34876199 ACTCTTTTTTTCACACAAATAGG + Intronic
1156958916 18:42999405-42999427 ACTTCACTTTTCACACTTCCAGG - Intronic
1159420752 18:68216469-68216491 ACTCTTTTTTTGATACTTCCAGG - Intergenic
1163103810 19:15111991-15112013 CCTGCATTTTTGACACATCCTGG - Intronic
1164251821 19:23483730-23483752 CCTCCTTTTGTCATACAACCTGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
926571305 2:14533276-14533298 ACTCCTCCTATCAAACATCCTGG + Intergenic
928044830 2:27919341-27919363 ACTCCTTATTTCCTCCATCCTGG + Intronic
929585215 2:43109586-43109608 AATCCTCTTTTCACACCCCCTGG + Intergenic
929731013 2:44492191-44492213 CCTCCTTTATTCTCACATACTGG - Intronic
930408448 2:50992739-50992761 ACTCTTTTTTTCACATGGCCTGG + Intronic
931446745 2:62333228-62333250 ACTCATTTTAAAACACATCCTGG + Intergenic
935015935 2:99182042-99182064 ACGCCTTTTTTCATACCCCCAGG + Intronic
936668848 2:114631964-114631986 ACTCCATTTTTTAAAAATCCAGG + Intronic
938335615 2:130493571-130493593 CCTCCTTCTTCCTCACATCCAGG + Intronic
938354208 2:130627092-130627114 CCTCCTTCTTCCTCACATCCAGG - Intronic
944613346 2:201433920-201433942 ACATCTTTTGTCACACATCATGG + Intronic
945365383 2:208946490-208946512 ACTCCTTCTCTCAGATATCCTGG + Intergenic
948223979 2:236294451-236294473 GCTCCATTTATCACACATCTAGG - Intergenic
1169669105 20:8075450-8075472 CCCCATTTTTTCACACCTCCTGG - Intergenic
1169903800 20:10580226-10580248 CCTCCTTTGTTCACCCTTCCAGG + Intronic
1170751467 20:19151129-19151151 ACTCCTTTTTTCAAATATATAGG - Intergenic
1171363957 20:24611100-24611122 ACTACTGTTTGCCCACATCCAGG + Intronic
1171721754 20:28570253-28570275 ACTCCATTTATCCCACATCATGG + Intergenic
1172514919 20:35526756-35526778 CCTCCTTGTTTCACCCATGCCGG - Intronic
1172840211 20:37898352-37898374 ACACATATTTTCACACATCCGGG + Intergenic
1172874890 20:38158253-38158275 ACCCCTTTCTTCCCAGATCCTGG + Intronic
1174451501 20:50623562-50623584 TCTCCTCCTCTCACACATCCTGG - Intronic
1177534058 21:22401646-22401668 ACTCCTTTTAACCCACATCATGG + Intergenic
1180295309 22:10928940-10928962 ACTCCCTTTATCCCACATCATGG + Intergenic
1181630059 22:24146354-24146376 TCTCCTTCCTTCCCACATCCTGG + Intronic
1182035644 22:27196191-27196213 AGTCCTTTTCTCACACATTGGGG + Intergenic
1182674096 22:32024033-32024055 ACTCCTCTTTTCTTACTTCCTGG - Intergenic
1182748792 22:32625573-32625595 TCTTCTTTCTTCACACATTCAGG + Intronic
1185067515 22:48639584-48639606 GCTCCCTTTGTCACACCTCCTGG + Intronic
1185153371 22:49179103-49179125 ACGCCTTTTTTCTGACATCATGG - Intergenic
949359787 3:3219674-3219696 ACAACTTTTTTCTCACATCTTGG + Intergenic
951569948 3:24051405-24051427 AATCATTTTTTCTCACATTCAGG - Intergenic
952006887 3:28851241-28851263 ACTGTCTTTTTCACACATCCTGG + Intergenic
953284912 3:41597115-41597137 ACCCCTGTTTTCACACAGCACGG + Intronic
960286675 3:115837642-115837664 TCTCCTTTTTTCACTCAACGAGG - Intronic
960433924 3:117602467-117602489 TCTCCTTTTTGCACACTTCCAGG + Intergenic
961836046 3:129660611-129660633 ACTTCTTATTTCATACATCTAGG + Intronic
961847802 3:129782629-129782651 ACTCCTTTTTTGACTCTTACAGG + Intronic
966261520 3:177984579-177984601 ACTCCTTTTCTCAAGGATCCTGG + Intergenic
968836094 4:2965211-2965233 CCTCCTGTTTTCACCCATGCTGG + Intronic
968990459 4:3907951-3907973 TCTCCCTTTTTCACACAGACTGG + Intergenic
970254728 4:14155543-14155565 ACTCCTTTATTTACACATGAGGG + Intergenic
970381942 4:15517303-15517325 GCATCTTTTTTTACACATCCAGG + Intronic
972584416 4:40423846-40423868 AGTACTTTTTTCACACAGTCAGG + Exonic
972875944 4:43360168-43360190 ACAGATATTTTCACACATCCTGG - Intergenic
973255817 4:48112168-48112190 TCTCATTCTCTCACACATCCTGG + Intronic
976064260 4:81165696-81165718 ACTCATCTTTTCAAACACCCTGG - Intronic
976844746 4:89474788-89474810 ACTTCTTTCTTTACAGATCCAGG + Intergenic
980935596 4:139222644-139222666 ATTCTTTTTTTCACAGAACCTGG + Intergenic
984167744 4:176322009-176322031 TCTCCTGTTTTCACACTTACAGG + Intronic
984586763 4:181573371-181573393 ATTCCCTTTTTTCCACATCCTGG + Intergenic
986916811 5:12629506-12629528 ACTCTTTCTTTGACACATCTAGG + Intergenic
989399667 5:40995181-40995203 ACTCTCTTTCTCACAAATCCTGG - Intergenic
990520390 5:56573744-56573766 ATTCCTTTACTCCCACATCCGGG + Intronic
990527035 5:56638317-56638339 GCTCCTGTTTACACACAGCCTGG + Intergenic
991481581 5:67086811-67086833 ACTCCTTCTTACTCTCATCCTGG + Intronic
993416962 5:87646792-87646814 ACTCATTTTTTTACACAAACAGG + Intergenic
995055887 5:107758253-107758275 ACTCCTCTGTTCACACACCCTGG + Intergenic
997889352 5:137661266-137661288 ACTCCTTTTTTTACACATGTAGG - Intronic
1001303085 5:170552223-170552245 ACTCATTTATTCACACATTGAGG + Intronic
1002875819 6:1207989-1208011 ATTCAGTTTTTCACACAGCCAGG - Intergenic
1004299508 6:14444471-14444493 CCTCCTTCTTTCCCACCTCCAGG + Intergenic
1004376007 6:15091341-15091363 CCTCCTTCTTTCACCCATGCTGG - Intergenic
1005778693 6:29165631-29165653 ACTTCTCTCTTCCCACATCCAGG + Intergenic
1006490582 6:34383983-34384005 AGTCCTTTTGTAACACATCTTGG - Intronic
1010564558 6:77393740-77393762 TCTCCTTTTGTCACCCATGCTGG + Intergenic
1011008525 6:82676407-82676429 AGTCCTTTTTTCTCTCTTCCAGG - Intergenic
1011260768 6:85467261-85467283 ACCCCTTTTCTCTCAAATCCAGG + Exonic
1013901906 6:115166992-115167014 ACTGCTTTATTCACAGTTCCTGG - Intergenic
1015495904 6:133883054-133883076 ACTTCTTCATTCACACATCCAGG - Intergenic
1019260757 7:80640-80662 ACTCCCCTGTTCACGCATCCCGG + Intergenic
1019405172 7:879385-879407 ACTCCTCTTTTCTCATTTCCTGG - Intronic
1020342736 7:7130316-7130338 ACTCCTGATTTCACACATTTAGG + Intergenic
1024186776 7:46957353-46957375 ACTTCTGTTATCACACATGCAGG - Intergenic
1024473676 7:49788922-49788944 ACTCATATTCTCACACATGCAGG - Intronic
1026976563 7:74502384-74502406 ACACCTGTTTCCAGACATCCAGG + Intronic
1027599260 7:80218929-80218951 CCTCCTTTTTTTACTCATCTTGG + Exonic
1031742519 7:125452730-125452752 ACTCCTCTTAACACACATCACGG - Intergenic
1034353410 7:150432127-150432149 ACTCCCTTTTCCACAGATCTTGG + Intergenic
1035520633 8:273370-273392 ACTCGTTTCTTCACACGTCTTGG - Intergenic
1037098074 8:15008993-15009015 TCTCCTGTTTTCACGTATCCTGG + Intronic
1039130664 8:34260859-34260881 ACTCCTGTTTTCCCACTTTCTGG - Intergenic
1040549211 8:48425460-48425482 ACACCATTTTCCACTCATCCAGG - Intergenic
1042253440 8:66779102-66779124 ATACCTTTCTCCACACATCCAGG - Intronic
1043220698 8:77659514-77659536 ACTCATTATTTCAAACATCTTGG - Intergenic
1046746016 8:117876933-117876955 CATCCTTTTTTCCCACAGCCTGG - Intronic
1046912323 8:119642006-119642028 CCTCCTGATTTCAGACATCCAGG + Intronic
1047102214 8:121689445-121689467 AGTCCTTTTTGCACAGTTCCTGG - Intergenic
1047794969 8:128245964-128245986 ACTCCATTTTTTACAAATCAGGG - Intergenic
1048027914 8:130603774-130603796 ATTCCTTTTTCACCACATCCAGG + Intergenic
1048411575 8:134180067-134180089 ATTCCTTTTTTTCCCCATCCTGG + Intergenic
1051948005 9:22595878-22595900 ACTCCTATTATCACACAAACAGG - Intergenic
1053619381 9:39800076-39800098 ACTGGTTTGTTCACACAACCTGG - Intergenic
1053877541 9:42559425-42559447 ACTGGTTTGTTCACACAACCTGG - Intergenic
1054234153 9:62542297-62542319 ACTGGTTTGTTCACACAACCTGG + Intergenic
1054264775 9:62907353-62907375 ACTGGTTTGTTCACACAACCTGG + Intergenic
1055702780 9:78963967-78963989 ACTGCTTTTCTAACACACCCTGG - Intergenic
1055970601 9:81908240-81908262 ACTCCTCTTAACACACATCATGG - Intergenic
1058277457 9:103062623-103062645 AGTTCCTTTTTCCCACATCCTGG - Intergenic
1060947040 9:127575822-127575844 AATCCATGTTTCACACAGCCAGG - Intronic
1061301145 9:129705661-129705683 ACTCCTTTTCTCAAGGATCCTGG + Intronic
1187131851 X:16510857-16510879 ACACCTTTTTTTATACATACAGG + Intergenic
1187977885 X:24722082-24722104 ACTCCTTTTTTCACACATCCTGG - Intronic
1188500998 X:30825932-30825954 TCCCCTTGTTTCCCACATCCTGG - Intergenic
1189832943 X:44993305-44993327 ATTCTTTTTTTCACACATAAAGG - Intronic
1190276729 X:48904011-48904033 CCTCCATTTTTCCCACACCCTGG + Exonic
1191199525 X:57764255-57764277 ATTTCTTTTTTCACACATCTTGG - Intergenic
1193477000 X:81978666-81978688 ACTCCTTTTAACCCACATCATGG + Intergenic
1196637917 X:118025100-118025122 ACTCCTGTTTTCACCCAACATGG + Intronic
1197895074 X:131304098-131304120 TCTTCTTTCTACACACATCCTGG - Intronic
1198014889 X:132600416-132600438 CTTCCTTTTTTCACTCATCAAGG + Intergenic
1198870036 X:141168645-141168667 CCTCCTTTTTTAACAAATCATGG - Intergenic