ID: 1187985272

View in Genome Browser
Species Human (GRCh38)
Location X:24803279-24803301
Sequence CTGGAGAGAAGGAGAGCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 6, 3: 102, 4: 639}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187985267_1187985272 24 Left 1187985267 X:24803232-24803254 CCTAGGAAGTGCTTGACAATATC 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG 0: 1
1: 0
2: 6
3: 102
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187985272 Original CRISPR CTGGAGAGAAGGAGAGCACA CGG Intronic
900291647 1:1926242-1926264 GGGGAGAGAAGGAAAGCACCAGG + Exonic
900595889 1:3480016-3480038 CTCGAGAGAGGGTGAGCACATGG - Intronic
900657668 1:3767740-3767762 CTGGAAAGGAGGAGGGCACCTGG + Intronic
900793418 1:4693769-4693791 CAGGAGGGCAAGAGAGCACATGG + Intronic
902153538 1:14464435-14464457 CTGGAGGGAAGGGGAGGACTTGG - Intergenic
902263633 1:15246139-15246161 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
902545682 1:17188770-17188792 CAGGAGAGAGAGACAGCACAGGG + Intergenic
903888491 1:26554935-26554957 CTGGGGAGAAGGCCAGCACTGGG - Intronic
904239027 1:29132164-29132186 CTAGAGGGAGGGAGAGAACAGGG + Intergenic
904291011 1:29485869-29485891 CTGGAGAGAAGGCTTGCTCAAGG - Intergenic
904358089 1:29954414-29954436 CTGGAGAGCAGAAGTGAACAAGG - Intergenic
905050535 1:35047204-35047226 CTGGAGAGAGGGGGAGCCCAAGG - Intergenic
905271945 1:36793053-36793075 CTGGAGACGAGAGGAGCACAAGG + Intergenic
905294982 1:36948586-36948608 AGGGTAAGAAGGAGAGCACAGGG + Intronic
905491882 1:38350788-38350810 AGGGTGAGATGGAGAGCACAGGG + Intergenic
905674451 1:39815963-39815985 ATGGAGAGAGAGAGATCACATGG + Intergenic
907809023 1:57850122-57850144 CTGAAGAGAAGGAGAGAACCAGG + Intronic
907854346 1:58287167-58287189 CTGGAGGGAGGGAGAGCATCAGG + Intronic
909132358 1:71753836-71753858 CTGGAGAGCAGAAGAACACCTGG + Intronic
909299263 1:73990617-73990639 CTTGAGGGAGGGAGAGCACCAGG - Intergenic
910105453 1:83626997-83627019 CTGAAGACAAGGAGGGCACAGGG + Intergenic
910167563 1:84343712-84343734 TTGGGGAGAAGGAGAGCATTAGG + Intronic
910322362 1:85961777-85961799 CAGGAGAGAGTGAGAGCAAAGGG + Intronic
910453605 1:87372313-87372335 CAGGAGAGAAGGAAAGGACAAGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911699025 1:100928306-100928328 CTGGAGTGTAGGAGAGAAAACGG + Intronic
912871405 1:113310472-113310494 CTTGGGGGAGGGAGAGCACAGGG + Intergenic
913128797 1:115818114-115818136 AGGGATAGAAGGAGAGCAGAAGG - Intergenic
913428165 1:118758160-118758182 GTGGAGTGAAGGAGAGTCCAGGG - Intergenic
913567062 1:120082873-120082895 TAGGAGAGAAGGAAAGCACAGGG + Intergenic
913631069 1:120710676-120710698 TAGGAGAGAAGGAAAGCACAGGG - Intergenic
913696777 1:121334211-121334233 GTGGAGAGAAGGAGGGTTCATGG - Intronic
914140783 1:144945849-144945871 GTGGAGAGAAGGAGGGTTCATGG + Intronic
914259372 1:145985997-145986019 CTGGACAGATGGATAGAACAAGG - Intergenic
914287814 1:146243579-146243601 TAGGAGAGAAGGAAAGCACAGGG + Intergenic
914548848 1:148694325-148694347 TAGGAGAGAAGGAAAGCACAGGG + Intergenic
914617833 1:149377393-149377415 TAGGAGAGAAGGAAAGCACAGGG - Intergenic
914761618 1:150603472-150603494 CTGGACCGTAGGAGAGCCCAAGG - Intronic
914823678 1:151125231-151125253 CTTGACAGAAGGACAGCACATGG - Exonic
915236531 1:154487481-154487503 CTGGAGAGAAGGAGATGAAATGG + Intronic
915289456 1:154873383-154873405 CTGGTGAGAAGGAAGGCAGAGGG - Intergenic
915343001 1:155186387-155186409 AGGGAGTGAAGGAGAGCAGAGGG - Intronic
915715858 1:157944138-157944160 CTGCAGAGAAGGAAAGCATGGGG - Intergenic
916723373 1:167502044-167502066 CCGGAGATAAGGAGGGGACAGGG + Intronic
916740660 1:167644548-167644570 AGGGAGGGAAGGAGAGCAGATGG + Intronic
917624388 1:176831019-176831041 CTGGAGAAAAGGGGGTCACATGG + Intronic
917921398 1:179753618-179753640 CTGGAGAGAAGGATAGGATAAGG + Intronic
918299068 1:183185962-183185984 CGGGAGAGAAGGAGGGCTCCGGG + Intergenic
918325914 1:183410627-183410649 CTAGAGTGCAGGTGAGCACAGGG - Intronic
918536733 1:185583066-185583088 CTGGAGAAAAAGAGCACACAGGG + Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919021924 1:192116771-192116793 ATGGAGAGAAGGAAAGGTCATGG - Intergenic
919211840 1:194496748-194496770 CGGGAGAGAGAGAGAGCAAAGGG + Intergenic
919212978 1:194511515-194511537 CAGGAGAGAGAGAGAGCACCAGG - Intergenic
919367765 1:196686045-196686067 CAGGAGAGACAGAGAGCAAAGGG + Intronic
919450013 1:197760275-197760297 ATGGAGAGAAAGAGAGGAGATGG - Intronic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
920067604 1:203280136-203280158 CTAGTGAGAAGGAGAGGCCAAGG - Intergenic
920316344 1:205078055-205078077 CTGGAGTGAAGAACAGGACAAGG - Exonic
920438963 1:205965843-205965865 GTGGAGTGAAGTAGAGCCCAAGG + Intergenic
920484108 1:206352565-206352587 GTGGAGAGAAGGAGGGTTCATGG - Intronic
920854852 1:209653975-209653997 GTGGAGAGAAAGAGACCACCAGG - Intergenic
921364508 1:214360968-214360990 CAGGAGAGAGAGAGAGCAAAGGG - Intronic
921807688 1:219474791-219474813 CTGGAGAAAGGGAGAGATCACGG - Intergenic
922669906 1:227501762-227501784 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
922700248 1:227755150-227755172 CTGGAGATAAGGGGAGGCCAAGG - Intronic
922724880 1:227918172-227918194 CTGGAGAGGAGGAGGGCCCTGGG - Intergenic
922932490 1:229401293-229401315 CTGGAGAGGCTGAGAACACATGG + Intergenic
923411529 1:233714808-233714830 CTGGTGAGGAAGAAAGCACAGGG + Intergenic
923509279 1:234635548-234635570 CTGGAGGTAAATAGAGCACAGGG + Intergenic
924127865 1:240874404-240874426 CTGGAGTGTAGGAGAGGAAAGGG + Intronic
924369633 1:243334209-243334231 CTGGAGGCAAGGACACCACAGGG - Intronic
1062813931 10:485401-485423 CCCGAGAGAAGGGGAGCAGAGGG - Intronic
1062999055 10:1897261-1897283 GTGCAAAGAAGGAGAGCAAACGG + Intergenic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1064980648 10:21163127-21163149 CTGGAGAGAAGGAGGTTAAATGG + Intronic
1065023707 10:21522018-21522040 CTGGAGCGAAGTAATGCACACGG + Intronic
1065625579 10:27625587-27625609 GTGGAGAGGCGGAGAGGACAGGG + Intergenic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1065819017 10:29508222-29508244 CTGGAGATAAGAAAAGCACCAGG + Intronic
1065953803 10:30675700-30675722 CTGGAGATAAGAAAAGCACCAGG - Intergenic
1066268385 10:33798288-33798310 ATGGAGAGATGGAGAGGGCAAGG + Intergenic
1066527499 10:36297105-36297127 CTTGAGAGAGGGAGAGCACAGGG - Intergenic
1067414363 10:46092296-46092318 CTGGAGAGGAAGAGAGCCCTGGG - Intergenic
1067771770 10:49131722-49131744 CTGGAGAGAAGGCGGGCTCAGGG - Exonic
1068305120 10:55198820-55198842 CAGGAGAGAGGGAGAGCAAAGGG - Intronic
1069595283 10:69666169-69666191 CAGGAGAGAAGCACAGCACGGGG + Intergenic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070643635 10:78186464-78186486 GTGGAGAGAAGGCAAGCACTGGG - Intergenic
1070971139 10:80568312-80568334 CTTGAGTGAAGGAGAGGGCAAGG + Intronic
1071573738 10:86711559-86711581 CTGGAGGGAAGGGGAGCGGAGGG - Intronic
1072739050 10:97898703-97898725 CTAGAGACAAGGAGAGCAGCTGG + Intronic
1072844710 10:98816993-98817015 AAGCAGAGAAGGAGAGCACAAGG - Intronic
1073762986 10:106650546-106650568 CCAGGGAGAAGGAAAGCACAGGG - Intronic
1073863779 10:107777309-107777331 CTGAGGTGAAGAAGAGCACATGG - Intergenic
1074400847 10:113140347-113140369 GTGGAGAGAAGCAGAGGGCAGGG - Intronic
1075476679 10:122741397-122741419 CTGTAGAGCAGGAGAGAATAGGG + Intergenic
1075588143 10:123672084-123672106 CTGGAAAGCAGGAGAGCCCCAGG + Intronic
1075635365 10:124026938-124026960 CTGGAGGGAAGGAGGGCTCCAGG + Intronic
1075803670 10:125169840-125169862 CTGCAGAGCTGAAGAGCACAGGG - Intergenic
1076473332 10:130735411-130735433 CTGGAGAGAAGTAAAGTACATGG + Intergenic
1076563787 10:131384707-131384729 CTGGAGAGAAGGTGAGTGCTTGG - Intergenic
1077734652 11:4776723-4776745 CAGGAGAGAAAGATAGCAAAGGG - Intronic
1078403011 11:11044669-11044691 CTGGAGAGGAGCACAGTACAGGG - Intergenic
1078445570 11:11402579-11402601 TTGGAGAGAAGGATTGCACATGG + Intronic
1078965184 11:16331122-16331144 CTGCAGAGGAGGAGAGCATGAGG - Intronic
1079188728 11:18260090-18260112 CTGGAGAGAATGAAGGGACAAGG - Intergenic
1079298551 11:19256889-19256911 CATGAGGGAAGGAGAGGACAAGG - Intergenic
1079757776 11:24286965-24286987 AGGGAGAGAGGGAGAGGACAAGG + Intergenic
1080052398 11:27870807-27870829 CTGGAGAGAAGGAGGATCCAGGG - Intergenic
1081061589 11:38485032-38485054 CTGGGGAACAGGAGATCACAGGG + Intergenic
1081614085 11:44580098-44580120 CAGGTGAGAAGGAGAGGGCAGGG - Intronic
1081995105 11:47359083-47359105 GGGGAGAGAAGGAGTGCAGAGGG + Intronic
1083091860 11:60208111-60208133 CTTGAGAGAAGGGAATCACAAGG - Intronic
1083101066 11:60306653-60306675 CTTGAGAGAAGGGAATCACAAGG + Intronic
1083367025 11:62147565-62147587 GTGCACAGAAGTAGAGCACAAGG + Intronic
1083458373 11:62794322-62794344 CTGGAGAGAGGGTGGGCACCGGG + Exonic
1083506717 11:63164635-63164657 CTGGAGAAAGGAAGACCACAGGG + Intronic
1083529646 11:63408089-63408111 CTGGAGAAAGGAAGAACACAAGG - Intronic
1083708911 11:64535326-64535348 CTGGAGCACAGGAGAGCAAAGGG + Intergenic
1083779471 11:64910492-64910514 ATGGAGAGATGTGGAGCACAGGG + Intronic
1084445167 11:69199399-69199421 CTGGAGAGAAGGGGAGAAACTGG + Intergenic
1085733881 11:79022337-79022359 CTGTAGAGAAGGGCACCACAGGG - Intronic
1085778139 11:79384387-79384409 CTGGAGGGAAGGACACCAAATGG - Intronic
1086049474 11:82572500-82572522 CAGGAAAGCAGGAGAACACATGG - Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087480311 11:98692309-98692331 CAGGAGAGAGAGAGAGCACGGGG - Intergenic
1087688412 11:101291268-101291290 CTGGAGAGAATGTGAGATCAAGG - Intergenic
1088117905 11:106333459-106333481 CAGGAGAGAAAGTGAGCAAAGGG + Intergenic
1088597382 11:111450455-111450477 CTGGACAGATGGAGGCCACAGGG + Intronic
1088704072 11:112445670-112445692 CTGCACAGAAAGAGAGCACCAGG - Intergenic
1088844256 11:113651678-113651700 TTGGACAGAATGAGAGGACAAGG - Intergenic
1089501428 11:118933880-118933902 CTTGACAGATGGAGAACACAAGG - Intronic
1089918245 11:122180737-122180759 CTGGAGAGAGGGAGAGAAACAGG - Intergenic
1089974688 11:122722311-122722333 CTGGAGTGCAGGAGAGAACCAGG - Intronic
1090411275 11:126511632-126511654 CTGGAGAGAAAGAGAGGTCCTGG - Intronic
1090923465 11:131229412-131229434 CTGGAGAATAGGAGACCACAGGG - Intergenic
1091283448 11:134395285-134395307 CTGGAGAGAAGGCTAGCTGAAGG + Intronic
1091689851 12:2588451-2588473 CAGGAGAGAGGGAGAGGGCAGGG - Intronic
1091838897 12:3605133-3605155 CTGGAGGGAAGGGGAGAGCAGGG + Intergenic
1091845224 12:3650642-3650664 CTGGAGAGAGGCAGGACACAGGG - Intronic
1091905485 12:4184084-4184106 GGGGAGAGAAAGAGAGGACATGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1094036832 12:26081123-26081145 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1094814740 12:34171658-34171680 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1095102192 12:38196924-38196946 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1096520230 12:52180839-52180861 CTGGAGGGAAAGAGGGCCCAGGG + Intronic
1097226240 12:57478180-57478202 CTGGAGGAAGGAAGAGCACAGGG + Intronic
1097322273 12:58239350-58239372 CTGGAAAAAAAGAGAGCAGAAGG - Intergenic
1098201289 12:68058654-68058676 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
1098703390 12:73657007-73657029 CTCAAGGGAAGGAGAGCAAAGGG - Intergenic
1098748785 12:74270217-74270239 CTGGAGAGAAGGGGTGAACTGGG - Intergenic
1099068264 12:78011890-78011912 CAGGTGAGAAAGAGAGGACATGG + Intronic
1099206797 12:79737782-79737804 CTGGTGGGAAGCAGAGCAAAAGG + Intergenic
1099532498 12:83801473-83801495 AGGGAGAGAAGGAGAGGAAAAGG + Intergenic
1100164392 12:91900181-91900203 CAGGAGAGAGAGAGAGCAAAAGG - Intergenic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1100523860 12:95402112-95402134 CTCAAGAGAAGGAGAACAGATGG + Intergenic
1100800397 12:98224606-98224628 CTGCAGAAAAGCAGATCACATGG - Intergenic
1101059885 12:100959755-100959777 CAGAAGAGAAGGTGAGCAAAGGG - Intronic
1102442553 12:112974856-112974878 CAGGAGAGGAGGTGGGCACAGGG - Intergenic
1102460228 12:113095302-113095324 CTGCAGAGAGGGACAGTACAGGG - Intronic
1102634914 12:114314612-114314634 CGGGAAAGACCGAGAGCACATGG - Intergenic
1102877970 12:116462422-116462444 GGGGAGAGCAAGAGAGCACATGG + Intergenic
1103723720 12:122987773-122987795 CTGGGGAGAAGGTAAGGACACGG - Exonic
1104442164 12:128802543-128802565 CAGGAGAGGAGGAGAGCCTAAGG + Intronic
1104770401 12:131358147-131358169 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1105074069 12:133259994-133260016 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
1105939668 13:25136214-25136236 CTTCTGAGAAGCAGAGCACAGGG - Intergenic
1105955593 13:25279308-25279330 CAGGAGAGAGAGAGAGCAAAGGG - Intronic
1105997580 13:25687095-25687117 GTGGAGCAGAGGAGAGCACATGG + Intronic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106118460 13:26837675-26837697 CAGGAGAGAAAGAGAGCAGAAGG + Intergenic
1106711062 13:32333748-32333770 GTGGGGGGAAGGAGAGCACCAGG - Intronic
1107221302 13:37984486-37984508 CAGGAGAGATCGAGAGCAAATGG + Intergenic
1107670671 13:42743507-42743529 CAGGTGAGAAGGAGAGACCAAGG + Intergenic
1108023998 13:46159687-46159709 CTGGAGAGAAGAAGAACATAAGG + Intronic
1108261282 13:48659141-48659163 CAGGAGAGGAGGAGAGCCCATGG + Intronic
1108823449 13:54381792-54381814 ATGAAGAGAAGGAGAAAACAGGG - Intergenic
1109707108 13:66110490-66110512 CTAGGGAGGAGGAGAGCATAAGG - Intergenic
1110370534 13:74735048-74735070 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1110893056 13:80713990-80714012 CAGGAGAGAAAGAGAGCAAGGGG + Intergenic
1111137165 13:84062964-84062986 CAGGAGAGAAAGAGAGCGAAGGG + Intergenic
1111628971 13:90825830-90825852 CTGGAGAAAGAGAGAGCACAGGG + Intergenic
1111688098 13:91526856-91526878 CAGGAGAGAGAGAGAGCACAGGG + Intronic
1112242644 13:97697130-97697152 CTGGATGGAAGGAGTGCAGAGGG - Intergenic
1112454546 13:99546847-99546869 CTGCATGGTAGGAGAGCACATGG + Intronic
1112460113 13:99596470-99596492 CAGGAGAGAGAGAGAACACAAGG - Intergenic
1112543389 13:100339731-100339753 CTGGAGAAAAGGAGAGCGGCTGG - Intronic
1113815146 13:113164357-113164379 CTGAAGAGAATGAGAACACATGG + Intronic
1114221444 14:20701303-20701325 ATGGAGTGAAGGCGAGGACAGGG - Intergenic
1114612968 14:24054149-24054171 CTGAGGAGCAGGAGAGCACCTGG + Intronic
1114843158 14:26289748-26289770 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1115343165 14:32314021-32314043 CCGTAGAGAAGTAGAGCACAGGG - Intergenic
1115562990 14:34599969-34599991 CTGGAGAGTAGGAGTGGAAAGGG - Intronic
1115700991 14:35952848-35952870 CTGCAGGAAAGGAGACCACAGGG + Intergenic
1115923251 14:38401948-38401970 CTTGAGAGAATGAAAGCTCATGG + Intergenic
1116753449 14:48916308-48916330 CAGGAGACAAAGAGAGCGCAGGG + Intergenic
1117271988 14:54154127-54154149 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
1117340326 14:54786567-54786589 CTGTCGAGCAGGGGAGCACAGGG - Intronic
1117880042 14:60304418-60304440 ATGGAAGGAAGGAGAGCACATGG - Intergenic
1118391116 14:65296455-65296477 CTGGAGAGCAGTTGAGAACAGGG - Intergenic
1118502953 14:66380364-66380386 CTGGAGAGCAGGTGGGCCCATGG + Intergenic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1118978915 14:70700568-70700590 CTGGAAAGAGGGTGAGCAAAGGG + Intergenic
1119020768 14:71110812-71110834 GTGGAGAGAAGCAGAGCACATGG - Exonic
1119074534 14:71622903-71622925 ATGGACACAAGGAGAGTACAGGG - Intronic
1119605717 14:76014655-76014677 CTGAGGAGAAGGAGAGGTCAAGG - Intronic
1119661751 14:76457104-76457126 CCGGAGAGAAGGAAATCCCAGGG - Intronic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1121015467 14:90546303-90546325 CTGCAGTGCAGAAGAGCACATGG - Intronic
1121095907 14:91217890-91217912 CTGGAGAGAAACAGAGGCCAGGG - Intronic
1121239487 14:92418428-92418450 CTCCAGAGAAGCAGAGCCCATGG + Intronic
1121623208 14:95364603-95364625 CTGCAGAGAAGGTCATCACAAGG - Intergenic
1122015379 14:98790732-98790754 CTGTAGAGAAGCAAAGAACATGG + Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122501364 14:102202191-102202213 CTAGAGGGATGGAGTGCACAGGG - Intronic
1123023542 14:105413081-105413103 TGGGAGAGAAGGGGAGCACCTGG - Exonic
1123502466 15:20902457-20902479 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1123559716 15:21476124-21476146 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1123595950 15:21913423-21913445 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1123670107 15:22647893-22647915 CTGGGGGGAAGGAGAGCATCAGG + Intergenic
1124004653 15:25786074-25786096 GTGGGGAGAAGGAGAGCTGAGGG + Intronic
1124864642 15:33477311-33477333 CCGGAGAAAAGGAGATCATATGG + Intronic
1125121223 15:36161103-36161125 ATGGAGAGCAGGAAAGAACAAGG + Intergenic
1127295702 15:57607140-57607162 CTGGAGTGAGGGACAGGACAAGG + Intronic
1127968404 15:63940925-63940947 ATGGAGAGATGGGGAGTACAAGG + Intronic
1128161378 15:65424864-65424886 CTGGAGAGGTGGTGAGCACAGGG - Intergenic
1128662184 15:69509824-69509846 AAGGAGAGAAGAAGAGCAAAAGG + Intergenic
1128752174 15:70157637-70157659 ATGGGGAGCAGGAGAGAACAGGG - Intergenic
1128818081 15:70629082-70629104 CTGGAAGGAAGGAGTGGACAGGG + Intergenic
1129105066 15:73301414-73301436 CTGAAGTGCAGGAGACCACAAGG + Exonic
1129884700 15:79030158-79030180 GTGGAGGGAGGGACAGCACAGGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1130654300 15:85781346-85781368 CTGGAGAGAATGAGTGAAAAGGG + Intronic
1130829973 15:87589459-87589481 CTGGAGACAAGGACACCAGAGGG + Intergenic
1130920324 15:88338433-88338455 CAGGAGAGAAGCAGAGGATAGGG + Intergenic
1131352602 15:91715168-91715190 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1131651971 15:94409932-94409954 CTGGAGAGAGGCAGAGTAGAGGG - Intronic
1132112722 15:99114267-99114289 CAGGAGAGAGAGAGAGCTCAGGG + Intronic
1132295898 15:100734162-100734184 CAGGAGAGAAAGAGAGCAAAGGG - Intergenic
1202968058 15_KI270727v1_random:203286-203308 CTTGGGAGAGGGAGAGCACTGGG + Intergenic
1132999434 16:2841600-2841622 CTGGAAAGCAAGAGAGCAAAGGG + Intergenic
1133520695 16:6553722-6553744 GAGGAGAGAAGGACAGCAAAAGG + Intronic
1133696341 16:8266621-8266643 CTGGAGAGAGAGAGAGCAAAGGG - Intergenic
1133917676 16:10124006-10124028 CTGGAAAGAAGGTGGGAACAAGG - Intronic
1134070422 16:11256606-11256628 CTGCAGGGGAGGAGAGGACAGGG - Intronic
1134486362 16:14661869-14661891 CTGCAGAGGAGAAGAGTACAGGG - Intronic
1135105573 16:19646251-19646273 GTGGTGAGAAAGAGAGGACATGG - Intronic
1137373385 16:47929544-47929566 CTAGAGGGAAGGAGATGACAAGG + Intergenic
1137374784 16:47943254-47943276 GTGGAGAGAAGCAGAGGACGGGG + Intergenic
1137442021 16:48505944-48505966 TTGGAGTGCAGGAGAGCACAGGG + Intergenic
1137646543 16:50080058-50080080 CTGGAGGAAGGGAGAGCACAGGG + Intronic
1137748643 16:50842019-50842041 GAGGAGAGAAGGACCGCACACGG + Intergenic
1137920097 16:52478442-52478464 CAAGAGACAAGGAGGGCACATGG - Intronic
1138177895 16:54918420-54918442 CTGGTGAGAAGGAGTGCTTAGGG - Intergenic
1138331890 16:56221950-56221972 CTGCATAGAAGCAGAGCACTGGG - Intronic
1138535153 16:57656042-57656064 CTGGAGGGAGGGAGAGGAAAGGG - Intronic
1139159070 16:64481300-64481322 CTGGAGAGAAGAATAATACATGG - Intergenic
1140477178 16:75244762-75244784 TTGGAGCCAAGGTGAGCACAAGG + Intronic
1140543419 16:75781894-75781916 CTAGAGAGAAAAAGAGCCCATGG - Intergenic
1140846566 16:78894324-78894346 CTGGAGAGAAGCAAAGAACCAGG - Intronic
1141094646 16:81154339-81154361 CTGAAGAGAAGGACAGCATTAGG + Intergenic
1141323774 16:83036711-83036733 CTGGGAAGAAGCAGAACACAGGG - Intronic
1141537634 16:84693639-84693661 CTGGATAGCAGGAGGGCACAGGG + Intergenic
1141656107 16:85417440-85417462 CTGGAGAGGGTCAGAGCACACGG + Intergenic
1142489082 17:266355-266377 CTGGAGTTGAGGGGAGCACAGGG - Intronic
1142761300 17:2043273-2043295 CTGAAGAAAAGGGGAGCACAAGG + Exonic
1143274475 17:5699933-5699955 CTGGAGAGGAGGAGAGGGAAGGG - Intergenic
1143357349 17:6340276-6340298 ATGGAGAGAAGGAATTCACAGGG - Intergenic
1145915765 17:28573208-28573230 CAGGCAAGAAGGAGAGCCCAGGG + Exonic
1146008282 17:29176112-29176134 CTGGAGAGTAGGGGAGAAGAAGG + Intronic
1146387642 17:32391536-32391558 CTGGAGAGAAGGAAATTACAAGG - Intergenic
1146540142 17:33686712-33686734 CTGGAGAGTAGGGCAGGACAAGG - Intronic
1146664931 17:34693262-34693284 CTGGTGAGAAGGGGAGCCCATGG - Intergenic
1146673925 17:34760026-34760048 CTGGAGGAAAGGAGACCGCAGGG + Intergenic
1146896674 17:36546017-36546039 CTGGAGAGAGGGAGTGCGTACGG - Intronic
1147054093 17:37820906-37820928 ATGCTGAGAAGGAGAGCAAAGGG - Intergenic
1147250658 17:39151127-39151149 CAGGAGAGAAGGAGAGGTCCGGG + Intronic
1147305860 17:39564009-39564031 CAGGAGAGAATGAGAGGACAGGG - Intronic
1147586248 17:41655359-41655381 CAGCAGAGAAAGAGAGCAGAGGG - Intergenic
1148142057 17:45336036-45336058 ATTGAGAGCAGGGGAGCACAGGG + Intergenic
1148654387 17:49272405-49272427 ATGGAGAGAGAGAGACCACAAGG + Intergenic
1148679582 17:49466033-49466055 GAGGAGGAAAGGAGAGCACAGGG - Intronic
1149045955 17:52245956-52245978 CTGGAGAGAAAGAGAGTGCTGGG - Intergenic
1150241012 17:63632658-63632680 CTGCAATGAAAGAGAGCACATGG - Intronic
1150993940 17:70294332-70294354 ATGGAGGGAAGGAGAGCATTAGG + Intergenic
1151186870 17:72371209-72371231 CTGGAGAGAAGGGGAGAAGGGGG - Intergenic
1151513033 17:74573360-74573382 CTGGATGGAATGAGAACACATGG - Intergenic
1152245257 17:79182116-79182138 CTGGAGAGAGAGAGAGTACAGGG - Intronic
1152735888 17:81996596-81996618 CTCAGGAGAAGCAGAGCACAAGG + Exonic
1152878558 17:82802535-82802557 CTGGAGACCAGGAGAGCTCATGG + Intronic
1153392233 18:4575009-4575031 CAGGAGAGAAAGACAGCAAAGGG - Intergenic
1153934925 18:9913348-9913370 CTGGATAGAATTAGAGCAAACGG + Intergenic
1154293266 18:13129198-13129220 CTGGAGGGAAGGACTGCACAAGG - Intergenic
1155580029 18:27293562-27293584 CCTGAGAGAAGGAGAGCATGTGG + Intergenic
1155596050 18:27488800-27488822 CAGGAGAGAAAGAGAGCAAAGGG + Intergenic
1156528859 18:37795749-37795771 CTGAAGAGAAGGAGAAAGCAAGG + Intergenic
1157063476 18:44320709-44320731 CTGCTGTGCAGGAGAGCACAGGG - Intergenic
1157077403 18:44480404-44480426 CAGGAGAGAGAGAAAGCACAGGG - Intergenic
1157131341 18:45010099-45010121 CTGCAGTGCAGGAGAGCGCATGG - Intronic
1157210757 18:45740018-45740040 CTGGAGAGCCCGTGAGCACAGGG - Intronic
1157264290 18:46204212-46204234 CTTGAGAGAATGAGAGAACAAGG - Intronic
1157421623 18:47552231-47552253 CAGGAAAGAAGGAGAGCAAAAGG - Intergenic
1157473608 18:48008010-48008032 CTGGAGAGGGGAAGAGCACAGGG - Intergenic
1157477022 18:48029968-48029990 CTGGAGAAAGGGGGAGCAAAAGG - Intronic
1157506095 18:48227840-48227862 AGGGAGAGAAGGAGAGGACAAGG - Intronic
1158643334 18:59221046-59221068 CTGGAAAGAGGGAGGGCAAAAGG - Intronic
1158915190 18:62118438-62118460 CTAGAGAGAAGGAAACCACAGGG + Intronic
1159064908 18:63559062-63559084 AAGGAGAGAAGGAGAGAAGAAGG - Intronic
1159122671 18:64188960-64188982 CTGTAAGGAAGGAGATCACAAGG + Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1160174322 18:76580284-76580306 CAGGAGGGAAGCAGAGAACACGG + Intergenic
1161443060 19:4303442-4303464 CTGGGGAGATGGAGATTACAGGG + Intergenic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1162767433 19:12928523-12928545 CTGGAGATGGGGTGAGCACAGGG - Exonic
1162820484 19:13220387-13220409 TCAGAGAGAATGAGAGCACATGG + Intronic
1163297321 19:16420851-16420873 CTGGCGGGAGGGTGAGCACAAGG - Intronic
1163787200 19:19280939-19280961 CGGGGGAGAAGGTGAGCAAAGGG + Intronic
1163889315 19:19996920-19996942 ATGTGGAGAAGGAGAGCACAGGG - Intergenic
1164292272 19:23879381-23879403 GAGGAGAGAAGGAGAGGAGATGG + Intergenic
1164598842 19:29547837-29547859 CTGTAGGGAACCAGAGCACATGG + Intronic
1165311558 19:35031697-35031719 CAGGAAACAAGGACAGCACAGGG + Intronic
1165445579 19:35855357-35855379 ATGGAAAGATGGAGAGCCCAAGG - Intronic
1166592880 19:44016773-44016795 CAGGAGAGAATGAGAGCAGGAGG - Intergenic
1166917101 19:46202905-46202927 ATGGAGAGAGGGCGAGGACAGGG + Intergenic
1167202257 19:48074118-48074140 GTGGGGAGAAGAAGAGCACCAGG - Intronic
1167217149 19:48172104-48172126 CTGGGGGGAAGGGGAGCACCGGG + Intronic
1167742153 19:51330147-51330169 GTGGAGAAAAGGAGAGGGCAAGG + Exonic
1167862742 19:52298204-52298226 CTGGTGACAACGAGAGCAGAGGG + Intronic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167873329 19:52391205-52391227 CCAGTGATAAGGAGAGCACAGGG + Intergenic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167960651 19:53102350-53102372 CTGGTGACAAGGCGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1168319295 19:55499734-55499756 CTGGAGAGAAGGAGGGGCCTGGG + Intronic
1168323954 19:55528708-55528730 CCGGAGAGAAGGAGAGAGGACGG + Intergenic
1168371303 19:55836709-55836731 CTGGAGAGAAGGAAAACGCTGGG - Exonic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925710170 2:6731463-6731485 CTGGAGAGCAGAATGGCACAAGG + Intergenic
925738138 2:6981987-6982009 CAGGAGAGAGAGAGCGCACAGGG + Intronic
925794809 2:7530275-7530297 CAGGAGAGAGAGAGTGCACATGG + Intergenic
926937758 2:18103458-18103480 CTGGAGAGCAGGACAGAATAGGG - Intronic
927024415 2:19050704-19050726 CTGGAGAGAAGGAAAGCAATGGG + Intergenic
927062941 2:19441254-19441276 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
928387976 2:30885638-30885660 CTGGAGAGACTGTGAGCAAAAGG + Intergenic
928475442 2:31622102-31622124 GTGGAGGGAAGGAGAGCATCAGG - Intergenic
929046156 2:37792555-37792577 CTGGAGCCAAGGAGAGGTCACGG + Intergenic
929529892 2:42743133-42743155 CTGGAGAGAAGAAAGGCAGATGG + Intronic
929588148 2:43128763-43128785 CTGGACAGAAGGAGTGGTCAGGG + Intergenic
930035636 2:47083602-47083624 CTGGAGAGCAGGAGGGGCCAAGG - Intronic
931462148 2:62458356-62458378 CTGGAGCCAAGGGGAGCAGAAGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932779308 2:74549918-74549940 TTGAGGAGAAGGAGAGCACCAGG + Intronic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
933776699 2:85775398-85775420 CTGGAGCACAGGAGAGCCCAGGG - Intronic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
934616322 2:95773417-95773439 CTGGCGAGAAGAAGGGCTCAGGG + Intergenic
934644574 2:96051143-96051165 CTGGCGAGAAGAAGGGCTCAGGG - Intergenic
934645544 2:96057158-96057180 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
934765911 2:96879894-96879916 TTGGAGGGAAGGGGAGCTCAGGG - Intronic
934781189 2:96970704-96970726 CAGGAGAAGAGGTGAGCACAGGG - Exonic
934837989 2:97607233-97607255 CTGGTGAGAAGAAGGGCTCAGGG - Intergenic
934838948 2:97613247-97613269 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
935132933 2:100274848-100274870 CTGGAGAAAAGGAGCGCACCAGG - Exonic
935368159 2:102316494-102316516 CTTCAGAGAAGGGGAGAACAAGG + Intronic
935498337 2:103808404-103808426 CTGGAGAGCAGAAGTACACAGGG + Intergenic
935875551 2:107502975-107502997 CTGGAGAGCAGGAGATAATAGGG + Intergenic
936850931 2:116896694-116896716 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
937090698 2:119204539-119204561 CTGGAGAGACAGGGAGAACAGGG + Intergenic
937714975 2:125021902-125021924 CTGGAGAGAAGAAGAAAACAGGG + Intergenic
937840867 2:126523288-126523310 GTGGGGAGAAGGAGAGCATGAGG + Intergenic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
938026317 2:127951972-127951994 ATGGAGAGAAGGAGAATATAGGG - Intronic
938241550 2:129746069-129746091 CAGGAGAGAGAGAGAGCGCAGGG - Intergenic
938275948 2:130022462-130022484 AAGGAGAGAAGAAGAGCATAAGG - Intergenic
938642038 2:133291431-133291453 CGGGAGGAAAGGAGAGCAGAGGG + Intronic
939475821 2:142685537-142685559 CTGCAGAGAAGGAGGCCTCAAGG + Intergenic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
939649096 2:144740149-144740171 GTGGGGAGAAGGAGAGCACCAGG - Intergenic
939727455 2:145740566-145740588 CAGGAGAGAGAGAGAGCACAAGG + Intergenic
940346301 2:152632299-152632321 CCTGAGAGCAGAAGAGCACATGG + Intronic
941501554 2:166284672-166284694 TTGGAGACAATGAGAGCAGAAGG - Exonic
941968839 2:171328206-171328228 CTGGATAGAGGGAGAGGAGAAGG + Intronic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
942232634 2:173874207-173874229 CTGGGGTGAGGGAGAGCGCACGG + Intergenic
942664020 2:178297201-178297223 CTGGAGAGAAAGACTGTACAAGG - Intronic
942972380 2:181971876-181971898 CTTGAGGAAAGGAGAGCAAAGGG - Intronic
943387657 2:187222757-187222779 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
943436571 2:187871037-187871059 CTGGGGAGAAGGGTAGCAGAAGG + Intergenic
944562732 2:200957016-200957038 GTGGAGGGAGGGAGAGCATAAGG + Intronic
945334958 2:208581433-208581455 CTGGAGAGTATGTGAGCATAGGG - Intronic
945662078 2:212698713-212698735 CAGGAGAGAGGGTGTGCACAAGG - Intergenic
946143436 2:217711296-217711318 CTGGAGACAGGGAGAGCCCATGG - Intronic
946396379 2:219445629-219445651 CGGGAGAGCAGGAGAGAGCAGGG + Intronic
946981401 2:225220085-225220107 GTGGAGGGAGGGAGAGCACTAGG - Intergenic
947159075 2:227193835-227193857 GGGGAGAGAAGGAGAGGAGAAGG + Intronic
947159092 2:227193902-227193924 GGGGAGAGAAGGAGAGGAGAAGG + Intronic
948066462 2:235084443-235084465 TTGGAGAGAAGAAAACCACATGG - Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
949019081 2:241730906-241730928 CAGGAGAGAAAGGGAGCAAAGGG + Intergenic
1168970169 20:1925481-1925503 CTGCACAGCAGGAGGGCACAGGG + Intronic
1169312973 20:4562979-4563001 CTGGAGATCAAGAGAGCAGAAGG - Intergenic
1169804125 20:9541879-9541901 CAGGAGAGAGAGAGCGCACAGGG - Intronic
1170624617 20:18021766-18021788 TGGGAGAGAAGGAGAGAAGAAGG + Intronic
1171405695 20:24910953-24910975 TTCAAGAGATGGAGAGCACAGGG - Intergenic
1171776510 20:29373174-29373196 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171817785 20:29803680-29803702 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171900452 20:30851591-30851613 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1172079864 20:32331634-32331656 GAGGAGAGAAAGGGAGCACAGGG - Exonic
1172315624 20:33951945-33951967 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1172525484 20:35598643-35598665 CAGGAAAGGAGGAGAGCAGATGG + Intergenic
1172955627 20:38756126-38756148 CAGGAGGGAAAGAGAGCAGAGGG + Intronic
1173162574 20:40663640-40663662 GTGGAGAGAGGGTGACCACATGG - Intergenic
1173240019 20:41286905-41286927 CAGGAGAGAGAGAGAGCTCAGGG - Intronic
1173735345 20:45357398-45357420 CTGGTGTGAAGGAAAGAACAGGG + Intergenic
1174838159 20:53877280-53877302 CTAGATTGAAGGAGGGCACAGGG - Intergenic
1175467068 20:59196640-59196662 CAGGAGAGGAGGAGATCACAGGG - Intronic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175745929 20:61457173-61457195 TTGGAGACAAGGAGCGGACAAGG + Intronic
1175923565 20:62461341-62461363 CTGGTGGGAAGGAGAGTGCAGGG + Intergenic
1176060932 20:63172711-63172733 CTGGAGGGAGGGACAGAACAAGG + Intergenic
1177649041 21:23937023-23937045 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1177914946 21:27077709-27077731 CAGGATAGAAAGAGAGCACTAGG - Intergenic
1178666096 21:34547731-34547753 CAGGAGACAGGGAGAGGACATGG - Intronic
1179078662 21:38149034-38149056 CTGGAGACCAGGAGAGCCAATGG - Intronic
1179378099 21:40870067-40870089 CGGGAGGGAGGGAGTGCACATGG + Intergenic
1179979965 21:44890761-44890783 CTGGGGAGCAGGAGAGCCCGTGG - Intronic
1180321233 22:11323169-11323191 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1180333810 22:11557576-11557598 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1180538211 22:16415688-16415710 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1180845100 22:18976470-18976492 CAGGAGAGATGCAGAGCACTAGG - Intergenic
1181363875 22:22358664-22358686 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181366688 22:22381750-22381772 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181373052 22:22432873-22432895 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1182003576 22:26940732-26940754 GTGGGAAGAAGGAAAGCACAGGG - Intergenic
1182464458 22:30505758-30505780 CTGGAGAGGAGGAGAGAACTGGG - Intergenic
1182789434 22:32937546-32937568 CAGGAGAGAGAGAGAGCAAAGGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1182983937 22:34698819-34698841 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1183553991 22:38510769-38510791 GTGGAGAGAAGGAAAGAACCTGG + Intergenic
1183782411 22:40007319-40007341 GAAGAGAGAAGGAGAGGACAGGG - Intronic
950153654 3:10707327-10707349 CTGGAGATGCGGAGAGCACTTGG + Intronic
950535844 3:13577696-13577718 CTGGAGAGAATGGGAGCAGGTGG + Intronic
951098109 3:18655121-18655143 CAGGAGAGAAGCAGAGCACAAGG + Intergenic
952055063 3:29434313-29434335 TTGGAGAAAAGGAGGGAACAAGG + Intronic
953273899 3:41475990-41476012 CAGGAGAGAAGGAGGGAAAAAGG + Intronic
953387812 3:42516539-42516561 CTGCAGTGAAGCAGAGCTCAGGG + Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953428927 3:42820781-42820803 CTGATGAGAAGGAAATCACAAGG + Intronic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
954869847 3:53759429-53759451 ATGGAGAGAAGCGGCGCACACGG + Intronic
954914471 3:54137013-54137035 CGGGAGAGAAGAGGTGCACAGGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
955319238 3:57962332-57962354 GTGGAGGGCAGAAGAGCACAGGG - Intergenic
955408798 3:58642716-58642738 CTGGAGGCAGGGAGACCACAAGG - Intronic
955414703 3:58681284-58681306 GTGAAGTCAAGGAGAGCACAGGG - Intergenic
955589049 3:60514498-60514520 GTGGGGAGAAGGAGAGCATCAGG + Intronic
956281243 3:67559432-67559454 CAGGAGAGAGAGATAGCACAAGG + Intronic
956767605 3:72497072-72497094 CTTGGGAGTTGGAGAGCACATGG - Intergenic
957087237 3:75692384-75692406 TTTGGGAGACGGAGAGCACAAGG + Intergenic
957088576 3:75706479-75706501 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
957155336 3:76537608-76537630 ATGGAGAGAGGGTGAGGACAGGG + Intronic
958441137 3:94157543-94157565 TTGTAGAGAAGAAGAGCAAATGG + Intergenic
958935273 3:100249922-100249944 CAGGAGAGAGAGACAGCACAGGG + Intergenic
958959192 3:100492679-100492701 GTGGCGAGAAGGAGAGGACGTGG - Exonic
959507269 3:107170275-107170297 CAGGAGAGAGAGAGAACACAGGG - Intergenic
959638902 3:108609007-108609029 CAGGAGAGAAAGAGACCAAAGGG + Intronic
960541832 3:118870323-118870345 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
960567616 3:119151204-119151226 CTGCTGAGAAAGAGAGCATAAGG - Exonic
961537203 3:127577343-127577365 CTGGTGAGCAGGAGTGCGCATGG + Intronic
962599952 3:136984197-136984219 CTGAAGATAAAGAGAGGACAAGG + Intronic
963233293 3:142931408-142931430 CTGGTGACAAGGAGGGCCCAGGG - Intergenic
963416590 3:145002677-145002699 CAGGAGAGAGAGAGAGCAAATGG + Intergenic
964271668 3:154963159-154963181 AGAGAGAGAGGGAGAGCACAAGG - Intergenic
964303115 3:155310799-155310821 CAGGAGAGAAGGTAGGCACAGGG + Intergenic
964749686 3:160042808-160042830 CTGGAGTGAAGTAGTGCAGATGG - Intergenic
966043226 3:175518013-175518035 CTGGAAAGGAGGAGAGAAGATGG + Intronic
967856488 3:194121645-194121667 CTGGAGAGCAGGAGAGCAGGAGG - Intergenic
968196741 3:196712783-196712805 CGGGAGGGAAGGAGGGCACACGG - Intronic
968357315 3:198119602-198119624 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
968553345 4:1235487-1235509 CAGGAGGGAAGGAGAGAACGCGG - Intronic
969435829 4:7188889-7188911 CCTGATAGAAGAAGAGCACACGG - Intergenic
969570510 4:8005585-8005607 CAGGCGGGAAGGGGAGCACATGG - Intronic
969986357 4:11215185-11215207 GTGGAGAGAAAGAGAGCAAGGGG + Intergenic
970087096 4:12362034-12362056 CAGGAGAGACAGAGAGCACAGGG + Intergenic
970109649 4:12623393-12623415 GTGGGGAGAAGGAGAGCATTAGG + Intergenic
970313705 4:14809217-14809239 GGGGAGAGAAGGAGAAGACAGGG + Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
972070519 4:35014134-35014156 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
973062448 4:45744566-45744588 GTGGAGAGAGGGAGAGCATTAGG - Intergenic
973122044 4:46533383-46533405 CTTGAGGGAAGGAAAACACATGG + Intergenic
973122632 4:46541666-46541688 CTTGAGAGAAGGAAAACACATGG - Intergenic
973864785 4:55101635-55101657 TTGGGGAGAAGGAGAGCATCAGG - Intronic
974568688 4:63613493-63613515 ATGGAGGGAAGGAGAGCATCAGG + Intergenic
974652199 4:64768507-64768529 CAGGAGAGAGAGAAAGCACAGGG + Intergenic
974930871 4:68359522-68359544 CAGGAGAGAAGGAGAACATTTGG - Intergenic
975369598 4:73569057-73569079 CTTGGGAGAAGGAGAGCACAAGG - Intergenic
975514277 4:75228267-75228289 GGGGAGAGAATGAGGGCACAGGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975674848 4:76816407-76816429 GTGCAGGGAAGGAGAGCACCAGG + Intergenic
976069965 4:81230314-81230336 CGGGAGAGAGAGAGAGTACAGGG - Intergenic
976926342 4:90502290-90502312 AGAGAGAGAAAGAGAGCACAAGG + Intronic
977732148 4:100366479-100366501 CTTGAGTGAAGGAGAGAAAAGGG - Intergenic
978050536 4:104194082-104194104 CTGGGGGGAAGGAGAGCATTAGG - Intergenic
978070643 4:104463922-104463944 CTAGATAAATGGAGAGCACATGG + Intergenic
979366274 4:119828108-119828130 CAGGAGAGAGAGAGTGCACAAGG + Intergenic
979609795 4:122677386-122677408 ATGGAGAGAGGGAGAGCATTAGG + Intergenic
980062475 4:128146626-128146648 CTGGAGAGAAGGAGGGGAATGGG + Intronic
981423354 4:144576795-144576817 GTGGAGAGAAGGAGAGAATCTGG - Intergenic
981759183 4:148174609-148174631 CTGGGGAGACGCAGAGCAAAGGG - Intronic
982438388 4:155403411-155403433 CAGGAAAGAAGGAAAGCACTGGG - Intergenic
983132976 4:164044383-164044405 CAGGAGAGAGAGAGAGCAAAGGG + Intronic
983530271 4:168803278-168803300 TTGGAGAGAGAGAGAGCAAAGGG + Intronic
983784154 4:171711039-171711061 CTGGAAATCAGGAGAGCAAATGG + Intergenic
984026471 4:174548676-174548698 CTGGAGGGAAGGAGAGGAAATGG + Intergenic
984877770 4:184384793-184384815 CTGGGGAGGAGGAGATCCCAGGG + Intergenic
985442071 4:189989244-189989266 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
985958265 5:3280729-3280751 CTGGAGAGTGGGATAGCATAGGG - Intergenic
986029600 5:3882054-3882076 CTGGAGAGAAGGTAGGCAGAGGG - Intergenic
986481620 5:8194647-8194669 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
987004230 5:13692829-13692851 CTGGAGAGAAAGGGAGCATGTGG - Intronic
987158419 5:15114783-15114805 CTGCAGAGAAGCAAAGCCCAGGG + Intergenic
988136376 5:27176316-27176338 CAGGAGAGACAGAGAGCCCAGGG + Intergenic
988234768 5:28527999-28528021 CAGGAGAGAGAGAGTGCACAGGG - Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988368546 5:30335482-30335504 ATAGAGAGAAAGAGAGAACATGG + Intergenic
988907183 5:35801792-35801814 CTAGAGAGAAGCAGATCTCAAGG - Intronic
989034045 5:37150942-37150964 CTGGGAACAAGGAGACCACATGG - Intronic
989088363 5:37700537-37700559 CTGGAGAGAAGGGAATCACATGG + Intronic
989193844 5:38696494-38696516 CTTGAGAGAAGGAGAGAATGTGG - Intergenic
989295378 5:39819356-39819378 TCGGGGAGAAGGAGAGAACACGG - Intergenic
989296842 5:39838544-39838566 CAGGAGAGAGGGAGAACAAAGGG - Intergenic
989786545 5:45338999-45339021 CTGAAGAGTAGGGAAGCACATGG + Intronic
990977569 5:61572943-61572965 CAGGGGTGACGGAGAGCACAGGG + Intergenic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
991252733 5:64581554-64581576 TTGGAGAGAAGGGGCACACAAGG + Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991505671 5:67321506-67321528 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
991534173 5:67648390-67648412 CTGGAGGGAATGGAAGCACAGGG + Intergenic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
991768714 5:70018634-70018656 CCGGTGTGAAGGAGAGCCCATGG + Intergenic
991847952 5:70893711-70893733 CCGGTGTGAAGGAGAGCCCATGG + Intergenic
991922000 5:71666265-71666287 CTGAAGAGAAGGAGAGAATGGGG - Intergenic
992220438 5:74566767-74566789 CTTGAGAGGAGGAGGGCACCAGG + Intergenic
992365317 5:76084131-76084153 CTGGAGAGCAGGGGAGCCCGCGG + Intronic
992579320 5:78155250-78155272 CTAGGGGGAGGGAGAGCACAGGG - Intronic
993630631 5:90281998-90282020 CTGGAGCTAAAGAGGGCACATGG - Intergenic
993836200 5:92823085-92823107 CAGGAGGGAAGGAGGGGACAAGG + Intergenic
994902754 5:105797534-105797556 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
994926305 5:106121127-106121149 CTGGTGACGAGGAGAGCAAAGGG - Intergenic
996496845 5:124168140-124168162 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
997130662 5:131273093-131273115 CTAGACAGAATGAGATCACAGGG - Intronic
997202239 5:132017978-132018000 CTGGAGAGAGAGAGAGAACAGGG + Intergenic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
997532032 5:134587307-134587329 GTGGAGAGAGAGAGAGCACTTGG + Intergenic
998010533 5:138691939-138691961 CAGGAGAGAGAGAGAGCACAGGG + Intronic
998372294 5:141669812-141669834 CTGGAGAGAAGATGAGGTCAGGG + Intronic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
998576954 5:143327222-143327244 CAGGAGAGAGAAAGAGCACAAGG + Intronic
998577234 5:143329212-143329234 CAGGAGAGAGAGAAAGCACAGGG + Intronic
999460997 5:151757732-151757754 CTGGAGAGATGGGGAGCCTAAGG + Intronic
999762669 5:154714650-154714672 CTGCAGGAAAGGAGAGAACAGGG - Intronic
999920054 5:156308265-156308287 CAGGAGAGAAAGAGAGCAAAGGG + Intronic
1000571820 5:162924199-162924221 GTGGAGGGAAGGAGGGCCCAGGG + Intergenic
1001133502 5:169083552-169083574 TTGAAGAGCAGGAGATCACAGGG - Intronic
1001342338 5:170859372-170859394 CTTGAAAGAAGGAAAGCACAAGG + Intergenic
1001833805 5:174812915-174812937 GTGGGGAGAAGGATAGGACATGG + Intergenic
1001962241 5:175886498-175886520 CTGGAGAGAAAGAGAACAAAAGG + Intergenic
1002309475 5:178306015-178306037 CTGGAGGCAGGGAGAGGACATGG + Intronic
1002329604 5:178432561-178432583 CAGGAAAGAAGCAGAGAACAAGG + Intronic
1003507354 6:6750993-6751015 GTGGAGAGAAGGTGGGCTCAGGG - Intergenic
1003520161 6:6851490-6851512 CTGGAGAAAAAGAGACAACAGGG + Intergenic
1003670266 6:8150870-8150892 CTGGAGACCAGGAGAGCTGATGG + Intergenic
1004753163 6:18584226-18584248 CTGGAAAGAAGGAGAGGCAATGG + Intergenic
1005173010 6:23009821-23009843 CTGGAGACCAGGAGAGCTGATGG - Intergenic
1006032482 6:31187314-31187336 GTGGAGAGAGGGAGAGTACGGGG + Intergenic
1006045117 6:31288550-31288572 CTGAATAGCATGAGAGCACATGG - Intronic
1006717070 6:36127486-36127508 TTGGAGAGGAGAAGAGCAAAGGG + Intergenic
1007262778 6:40575416-40575438 CAGGAAAGAAGGAGGGCAGATGG + Intronic
1007355269 6:41310446-41310468 CCTGAGAAAAGGAGAGCCCAAGG - Intergenic
1008482681 6:52002681-52002703 AGGGAGAGAAGGAGAAGACAAGG + Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008571392 6:52820544-52820566 CTGGAAAGAAGGAGCCCACCTGG - Intergenic
1009562087 6:65259246-65259268 CAGGAGGGAAGAAGAGGACATGG - Intronic
1010343127 6:74780802-74780824 CTTGGGAGAAGGTGAGCACAGGG + Intergenic
1010392913 6:75357318-75357340 CTGGAGAAAAAAACAGCACATGG + Intronic
1010510012 6:76706779-76706801 CTGGAGAGAAAGAAAGCTCATGG - Intergenic
1011230391 6:85154825-85154847 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1011322937 6:86116731-86116753 CTTGAGAGAGGAACAGCACAAGG - Intergenic
1011370947 6:86635579-86635601 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1013701643 6:112777409-112777431 CTGGAGAGCCGGAGGGCTCATGG + Intergenic
1014012534 6:116492907-116492929 ATGGAGAGAAAGAGAGGAGATGG - Intergenic
1014301676 6:119689626-119689648 CAGGAGAGAAAGAGAGCAAAGGG - Intergenic
1014741324 6:125150946-125150968 CTGGACAGAGGAAGAGAACATGG - Intronic
1014756183 6:125303711-125303733 CAGAAGAGAAAGAGAGCAAAGGG - Intergenic
1015483304 6:133740236-133740258 CAGGAGAGAGAGAGCGCACAGGG + Intergenic
1015652640 6:135479928-135479950 CTGGAGAGAGAGTGAGCAAAGGG - Intronic
1015775427 6:136809301-136809323 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016402897 6:143699793-143699815 TTGGAGAGAAGGAGCGAAAAGGG - Intronic
1016666541 6:146648536-146648558 CAGGAGAGAGGGAGAGTAAAGGG + Intronic
1017539048 6:155380946-155380968 CTGGACAGAATGATAGCACTGGG - Intergenic
1017570671 6:155741434-155741456 CTGCAGAGAAGGAGGCCACTGGG + Intergenic
1017776317 6:157683782-157683804 CTGGAGATAATGAGAACAGATGG + Intergenic
1018355475 6:163010756-163010778 CTGGGCAGAAGGAGACCCCAGGG + Intronic
1019155272 6:170034289-170034311 CTGGAGAGAAGGGGAGGGAAGGG + Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019285884 7:222667-222689 CTGGAGAGCAGCCCAGCACAAGG + Intronic
1020318530 7:6924220-6924242 CAGGAGAGTAAGACAGCACAGGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021781860 7:24114244-24114266 CTGGAGCGGATGAGAGCAGAGGG + Intergenic
1021953090 7:25794946-25794968 GTGGTGAGATGGTGAGCACAGGG - Intergenic
1022469843 7:30675320-30675342 CTGGTGGTAAGGAGTGCACAGGG + Intronic
1023218845 7:37897347-37897369 CTGGAGGGATGGAGACAACAGGG + Intronic
1023328631 7:39088730-39088752 CAGGAGACAAGCAGAGCTCAGGG + Intronic
1023528294 7:41128094-41128116 CAGGAGGAAAGGAGAGAACAGGG + Intergenic
1024417159 7:49120409-49120431 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1024468705 7:49742904-49742926 CTGCAGAGAAGGTGGGGACAAGG - Intergenic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1024829469 7:53432683-53432705 CTGGAGTGAAGGAGTACAGACGG + Intergenic
1024875136 7:54013570-54013592 CAGGTGAGCAGGAGAGCAGATGG + Intergenic
1024978228 7:55133384-55133406 CTGGAGAGCTGGTGAGCACCAGG - Intronic
1025079498 7:55969440-55969462 CTGGAAAGAAGAGGAGCAGATGG - Intronic
1025622483 7:63186516-63186538 CAGGAGGAAGGGAGAGCACAGGG - Intergenic
1025945145 7:66099378-66099400 GAGGAGAGAAGGAGAGGAGAAGG + Intronic
1026949578 7:74338425-74338447 CTGCAGAGAAGGAGAGGGAAAGG - Intronic
1028210578 7:88069247-88069269 AAGGAGAGAAGGAAAGCAGAAGG - Intronic
1028460406 7:91085646-91085668 ATGGAGTGAAGCAGAGCACAGGG + Intronic
1028661622 7:93283811-93283833 CATGAGAGTAGGAAAGCACAGGG + Intronic
1030162024 7:106518647-106518669 AAGGAGAGAAGGAGAGGAGAGGG - Intergenic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1031178470 7:118383467-118383489 CAGGAGAGAGAGAGAGCACAGGG - Intergenic
1031732634 7:125317132-125317154 CTTGAGAAAAGCAGAGGACAAGG + Intergenic
1032120163 7:129149767-129149789 CTGGAGTGGAGGAGTCCACAGGG - Intronic
1032358342 7:131230713-131230735 CTGTAGGGAAGGAAGGCACAGGG - Intronic
1033168102 7:139058728-139058750 CTGGAGAGGGGAAGAGCAAATGG + Intronic
1033192712 7:139296627-139296649 CTGGACAGGAGGAGAGGAAAGGG - Intronic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1035055693 7:156034540-156034562 CAGGAGAGAGCGAGAGCAAAAGG + Intergenic
1035332054 7:158102830-158102852 CTGGGGAGAAAGACAGCACACGG + Intronic
1035494960 7:159316571-159316593 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
1035553281 8:545395-545417 CGGGGGAGAAGGAGAGAACCGGG - Intronic
1036636111 8:10550562-10550584 CTGGAGAAAATTGGAGCACAGGG + Intronic
1036700623 8:11011411-11011433 CTGGAAAGCAGGTGAGCACCAGG + Intronic
1037351404 8:17961713-17961735 TTGGAGATAAGGAGAGAAAAAGG - Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038347355 8:26744627-26744649 CTGAACAGAAGGAATGCACAGGG + Intergenic
1038402531 8:27296304-27296326 CTGGGGAGAGGGAGAGCATCAGG - Intronic
1039114132 8:34073337-34073359 CAGGAGAGAGCGAGAGCAAAGGG + Intergenic
1039378111 8:37057778-37057800 CAGGAGAGAAAGAGCACACAGGG - Intergenic
1039731859 8:40288349-40288371 CAGGAGAGAGGAAGAGCCCAGGG - Intergenic
1039831902 8:41222019-41222041 GTGGAGAGGTGGGGAGCACATGG + Intergenic
1040733618 8:50479699-50479721 CTGAAGAGGAGGAAGGCACAGGG - Intronic
1041625464 8:60020910-60020932 GTGGAGGGAAGGAGAGCATCAGG - Intergenic
1042082665 8:65071942-65071964 CTTGGGAGAGGGTGAGCACAGGG - Intergenic
1042372570 8:68008433-68008455 CATGAGAGAAGGAGAGAATATGG + Intronic
1042807012 8:72781964-72781986 CTGGGGAGAGGGAGAGCATCAGG + Intronic
1043065847 8:75568974-75568996 CAAGAGAGAGAGAGAGCACAAGG + Intergenic
1044765676 8:95571496-95571518 CAGAAGAGAAAGAGAGCAAACGG - Intergenic
1044820337 8:96152077-96152099 GTGGAGAGAAGTGGACCACAAGG - Intronic
1044905656 8:96999370-96999392 CTGGGAAGAGGGAGAGGACAAGG - Intronic
1045643612 8:104279265-104279287 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
1045714239 8:105022779-105022801 CTGGAGGGAAGGAGAGACGAAGG - Intronic
1046358990 8:113125810-113125832 CTGATGAGAAGGAGAGGAAAAGG + Intronic
1047429568 8:124779423-124779445 CTGGAGAGCAGTAGAGATCACGG + Intergenic
1047638195 8:126789780-126789802 CTGTAGAGAATGAGAACACATGG - Intergenic
1047744873 8:127837243-127837265 CTGGATGGAAGGCGAGCCCATGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1047872142 8:129095880-129095902 CAGGAGAGAGAGAGAGCAAAGGG - Intergenic
1048709047 8:137187487-137187509 CTGGAGAGAAGTAGGGGAAAGGG + Intergenic
1048759855 8:137782220-137782242 GTAGAGAGAAGGAGAGAGCAGGG - Intergenic
1048966899 8:139621688-139621710 CTGGGGAGAAGGACACCATATGG + Intronic
1048999110 8:139813518-139813540 CTAGAGAGGAGGGGAGCACCAGG + Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049545676 8:143229499-143229521 CTGGAGAGGAGGAGCCCTCAGGG - Intergenic
1050302812 9:4276351-4276373 CGGGAGGGAAGGAGAGGGCACGG + Intronic
1051190756 9:14509608-14509630 TTGGAGAAAAGGAGAGGGCAAGG - Intergenic
1052175866 9:25462684-25462706 CAGGAAAGAAAGAGGGCACAGGG + Intergenic
1052251899 9:26408457-26408479 CTTGAGACAAGGAGAACAGATGG - Intergenic
1052869266 9:33487365-33487387 TTGGAGGGAAGAAGAACACAAGG - Intergenic
1053546903 9:39032671-39032693 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1053811222 9:41854324-41854346 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1054619372 9:67333115-67333137 CAGGAGAGAGAGAGAGAACAGGG + Intergenic
1054927939 9:70606933-70606955 CTGGAGAGCAGAGGGGCACATGG + Intronic
1055174913 9:73305797-73305819 CCAGAGAGAATGAGAGCAAAAGG - Intergenic
1055844841 9:80549031-80549053 GGGGAGAGAAGAAGAGCAAAGGG - Intergenic
1057713328 9:97466997-97467019 CTGGACCAAAGGAGAACACAGGG + Intronic
1057723080 9:97548460-97548482 CAGGAGAGAAGGTGAGGACGAGG + Intronic
1058545191 9:106053686-106053708 CTGCCGACAAGAAGAGCACAAGG - Intergenic
1059457622 9:114409619-114409641 CTGGAGAGGATGTGAGCAAAGGG - Intronic
1059971373 9:119672325-119672347 CAGGAGAGGAGGAGAGGAGAAGG - Intergenic
1060007859 9:120016285-120016307 CAGGAGAGAGAGAGAGCACAGGG + Intergenic
1060516963 9:124271959-124271981 CAGGAGACACGGGGAGCACAAGG - Intronic
1060677830 9:125532196-125532218 ATATAGAGAAAGAGAGCACATGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1061083323 9:128385202-128385224 CTGGACAGAAGGATAACACATGG - Intronic
1061278251 9:129581842-129581864 CTGGAGAGAAGGGGATGAGAAGG + Intergenic
1061475021 9:130859420-130859442 CTGGTGAAAAGCCGAGCACATGG + Intronic
1061650148 9:132041055-132041077 CAGCAGAGAAGAAGAGCAGAAGG + Intronic
1062127467 9:134871345-134871367 CTGTCGAGAAGGAGGACACAGGG - Intergenic
1062294514 9:135817129-135817151 CTGGATCGAAGGAGACTACAGGG + Intronic
1062312825 9:135948538-135948560 CTGGATGGCAGGGGAGCACAGGG - Intronic
1203369445 Un_KI270442v1:288942-288964 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186302704 X:8217960-8217982 GTGGAGAGAAGCAGACCACCAGG + Intergenic
1187462750 X:19502406-19502428 CAGGAGAGAGAGAGAGCACAGGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187952172 X:24481687-24481709 CAGGAGAGAGAGAGAGCAAAGGG - Intronic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1189375630 X:40464423-40464445 GTGGAAAGGGGGAGAGCACATGG - Intergenic
1189552002 X:42102851-42102873 CTGGGGAGAAGGAGAGCATGGGG - Intergenic
1189862300 X:45286111-45286133 CTGGGGATAAGGAGATTACAGGG - Intergenic
1190277520 X:48908523-48908545 TTGGAGACCAGGAGTGCACAGGG - Intronic
1190997132 X:55620774-55620796 CAGGAGAGAGAGAGAGCAAAGGG + Intergenic
1191136292 X:57068542-57068564 GTGGGGAGAAGGAGAGGACGAGG - Intergenic
1191656433 X:63603887-63603909 CAGGAGAGAGAGAGGGCACAGGG - Intergenic
1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG + Intergenic
1193775975 X:85642075-85642097 CTGGGGAAAAGGAGAGCATCAGG - Intergenic
1194898401 X:99474103-99474125 CAAGAGAGAAAGAGAGCAAAGGG - Intergenic
1195659240 X:107361997-107362019 CTGAAGAGAAGGACAGCATTTGG - Intergenic
1195768175 X:108319017-108319039 ATGGAGAGTAGGAGAGAACATGG + Intronic
1196384959 X:115139682-115139704 CTTGGGGGAGGGAGAGCACAGGG + Intronic
1197366150 X:125567100-125567122 CTGGAGAGAAAGAGACCCCATGG + Intergenic
1197942410 X:131803462-131803484 ATGAAGAGAAGGATACCACAAGG + Intergenic
1198119213 X:133575562-133575584 CTGGACCGAAGAACAGCACATGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198430938 X:136565525-136565547 CTTGGGAGAGGAAGAGCACAGGG - Intergenic
1198956330 X:142135740-142135762 CTTAACAGAGGGAGAGCACAGGG + Intergenic
1199034393 X:143033230-143033252 CTGGAGAAAATGAGAGAATAAGG + Intronic
1199051118 X:143238208-143238230 TTGAAGAGAAGGAGAGCACTGGG + Intergenic
1199062712 X:143377484-143377506 CAGGAGAGAGAGAGAGCAGAAGG + Intergenic
1199435497 X:147807938-147807960 TTGGAGAGAAGGAGATGACAGGG + Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1201068834 Y:10126018-10126040 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1201737185 Y:17280581-17280603 ATGGAGGGAGGGAGAGCATAAGG + Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic