ID: 1187985688

View in Genome Browser
Species Human (GRCh38)
Location X:24808229-24808251
Sequence GCCCTTCATGGCCACCGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187985682_1187985688 11 Left 1187985682 X:24808195-24808217 CCTGCTCAGCATGTTAGCTTGCA 0: 1
1: 0
2: 2
3: 6
4: 86
Right 1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 114
1187985681_1187985688 12 Left 1187985681 X:24808194-24808216 CCCTGCTCAGCATGTTAGCTTGC 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 114
1187985680_1187985688 16 Left 1187985680 X:24808190-24808212 CCGGCCCTGCTCAGCATGTTAGC 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 114
1187985678_1187985688 27 Left 1187985678 X:24808179-24808201 CCACCTTGCAGCCGGCCCTGCTC 0: 1
1: 0
2: 1
3: 45
4: 305
Right 1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 114
1187985679_1187985688 24 Left 1187985679 X:24808182-24808204 CCTTGCAGCCGGCCCTGCTCAGC 0: 1
1: 0
2: 3
3: 29
4: 398
Right 1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187985688 Original CRISPR GCCCTTCATGGCCACCGTGA TGG Intronic
900591822 1:3463542-3463564 GCCCTTCATGGCCGCCCGGTAGG - Exonic
904675670 1:32197932-32197954 AGCCCTCAGGGCCACCGTGATGG - Exonic
904951168 1:34240215-34240237 GTCCTTCATGCCCACCAGGAGGG + Intergenic
906937661 1:50228162-50228184 TGCCTTCATGGCCACCTTGAGGG - Intergenic
907737486 1:57128846-57128868 CCCCTTCATGGGCATAGTGAGGG - Intronic
910664788 1:89712842-89712864 GCCTTTCATTTCCACAGTGATGG - Exonic
912158378 1:106950317-106950339 GCCCTTGATGGAGCCCGTGATGG - Intergenic
915586932 1:156849009-156849031 GCGCTTCGTGTCCAACGTGACGG - Exonic
916607686 1:166359154-166359176 TCCCTTCATGGAAACCATGATGG + Intergenic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1064430708 10:15267768-15267790 GCTCCTCATGGCCACCCTGCTGG - Intronic
1067743411 10:48914093-48914115 GCAATTCCTGGCCACCTTGAGGG + Exonic
1069654761 10:70079527-70079549 GCCCTTGAAGGCCACGTTGAGGG + Intronic
1070628749 10:78069441-78069463 GGCCATCATGGCCATCGTCAAGG - Intergenic
1072549724 10:96468356-96468378 GCCCCTCATGGCCAGCCTGCTGG - Intronic
1076563248 10:131381246-131381268 GCCCTTCGCGGCCACAGGGATGG - Intergenic
1076859483 10:133133897-133133919 GCCCTTCATGCCCGCCGTGCTGG + Intergenic
1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG + Intergenic
1077609689 11:3636660-3636682 GCACTTCATGCCCGCTGTGATGG - Intergenic
1078991231 11:16648322-16648344 GCCTGCCATGGCCACTGTGAGGG - Intronic
1083267472 11:61553445-61553467 GCCCTTCCTGGCCTCGGGGAAGG - Intronic
1083616835 11:64030308-64030330 GCCCTTCAAGGCAACAATGACGG - Intronic
1084692251 11:70734206-70734228 GCCCTTCCAGGGCACCGTGACGG + Intronic
1085056230 11:73405683-73405705 GCCATTCATGGCCCAAGTGAAGG - Intronic
1088087471 11:105998133-105998155 GGCCTTCTAGGCCACTGTGAGGG - Intronic
1088677435 11:112208584-112208606 GCCCATCATGACCCCCGAGAAGG - Intronic
1088815139 11:113415522-113415544 GCCCTTCATTGTCACCCTGCTGG - Exonic
1089492670 11:118893673-118893695 GCCCCTCATGGCCTCCTTCAAGG + Exonic
1090051038 11:123379877-123379899 GCACTTCATGGCCACTAGGATGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092153023 12:6264089-6264111 GCCCATGCTGGCCACAGTGAGGG - Intergenic
1099674196 12:85736446-85736468 CCCCTTCAAGGCCAGAGTGATGG - Intergenic
1101416166 12:104509994-104510016 GGCTTTCAAGGCCACGGTGAAGG + Intronic
1104854372 12:131895078-131895100 GCCCTTGAAGACCACCGCGAAGG - Exonic
1107761531 13:43684495-43684517 ACCCTTCATGGCCACTCAGAAGG - Intronic
1121439387 14:93939261-93939283 GCACTTCATGGCGAACATGATGG + Exonic
1121501543 14:94442206-94442228 GCCCATATTGGCCACTGTGAAGG + Intergenic
1121585572 14:95060820-95060842 GGCCTTCAAGGCCACCCTAAAGG + Intergenic
1124020841 15:25921518-25921540 GGCCATGATGGCCACGGTGAAGG - Intergenic
1124231930 15:27953358-27953380 CCCCTCCCTGCCCACCGTGAAGG + Intronic
1125730890 15:41892318-41892340 GACCCTCATGGCCAGGGTGAGGG - Intronic
1130994235 15:88895207-88895229 GACCCTCGTGCCCACCGTGAGGG - Intronic
1134827991 16:17299846-17299868 GTCCTTCATGTCCACCAGGATGG - Intronic
1135429770 16:22373817-22373839 GCCTTTCATGGCCAGCGTGGAGG - Intronic
1138201433 16:55091524-55091546 GCCCTGCCTGCCCACCGTGCCGG + Intergenic
1141314976 16:82953402-82953424 GACCTTCATTGCCACCATCAGGG - Intronic
1142704802 17:1688097-1688119 GCACTCCATGGCCACCATGCTGG + Intergenic
1143922632 17:10342889-10342911 GACCATCCTGGCCACCATGATGG + Intronic
1144667366 17:17111356-17111378 GGCCTTCATGGCCAGGGTGCTGG - Intronic
1144768199 17:17744341-17744363 GACCCTCATGGCCACCCTGAGGG - Intronic
1145005921 17:19337737-19337759 TCCCTTCATAGCCACCTTCAGGG - Intronic
1145235933 17:21208455-21208477 GCCTTTCATGGACACCGAGAAGG - Intronic
1146212011 17:30950232-30950254 GCCCTTCATGGCCAACATCATGG + Intronic
1146357184 17:32143838-32143860 ACCCCTCAGGGTCACCGTGATGG + Intronic
1148677574 17:49454066-49454088 TCCCTTCATGGGGACAGTGAGGG + Intronic
1148783174 17:50132934-50132956 GCCCTTCAAGGTCACCTTGGTGG - Intergenic
1152007574 17:77692007-77692029 GCCCTTGCCGGCCACTGTGACGG - Intergenic
1153824620 18:8864169-8864191 GCCCTTTGTGGCTACTGTGATGG - Intergenic
1154945490 18:21157889-21157911 TCCCTCCATGTCCACCGAGAGGG - Intergenic
1160531501 18:79567637-79567659 GCCCCTCAAGGGCACCGTGGGGG + Intergenic
1163263152 19:16203509-16203531 GCACTTCATGCCCATCCTGATGG + Exonic
1163574770 19:18104250-18104272 GACCCTAATGGCCACGGTGATGG + Intronic
1164173231 19:22745892-22745914 CCCCTTCATGGCAACCACGAAGG + Intergenic
1165803396 19:38566249-38566271 GACCATCCTGGCCACCGTGGTGG + Intronic
1166731350 19:45060749-45060771 GCGATGCATGGCCATCGTGAAGG + Intronic
927318901 2:21720060-21720082 GCCCCTCAAGGGCACCCTGAGGG + Intergenic
933720663 2:85395457-85395479 GCCCTTCCTGGCCAATTTGAGGG + Intronic
936076300 2:109403883-109403905 CCCCACCATGGCCACTGTGAGGG + Intronic
938127839 2:128687192-128687214 TCCCTCCATGGCCTCCTTGACGG + Intergenic
941917624 2:170822777-170822799 GCCCTCCATGGCCTGCCTGAGGG + Intronic
1169263438 20:4153728-4153750 GCCCTTCCTGACAACCATGAAGG - Intronic
1169278389 20:4248486-4248508 GCCCTTCTCGGCCACCATGGAGG - Exonic
1170926334 20:20727791-20727813 GGCATTCATGGCCACAGGGATGG + Intergenic
1171891955 20:30724977-30724999 GCTCTTCATGGTAACCGGGATGG + Intergenic
1172183098 20:33015618-33015640 CCCCTTCATGGTCCCCATGAAGG + Intronic
1175206821 20:57317553-57317575 GACCATCCTGGCCACCGTGTGGG + Intergenic
1176135865 20:63521729-63521751 CCCGTTCATGGCCACGGTGTTGG + Exonic
1179123135 21:38567203-38567225 GCCCAGCATGGCGACCCTGAGGG + Intronic
1183489858 22:38110510-38110532 CCCCTCCATGGCCCCCGAGATGG - Exonic
950527000 3:13530039-13530061 GCCCTTCCTGGCCACAGTCTGGG + Intergenic
950680880 3:14584366-14584388 GTCCTTCAAGCCCACCGTGGAGG + Intergenic
954730269 3:52654607-52654629 CCCCTTCAAGGTCACCTTGAAGG - Intronic
964670514 3:159220208-159220230 GCTCTTCATGGCCTCTGTTATGG + Intronic
968500543 4:947871-947893 GTCCATCATCGCCACCGTCATGG + Exonic
968701662 4:2060535-2060557 GCCCTTCCTGGCCAGCGTCCGGG - Intronic
984083827 4:175283672-175283694 GCCATTCATGGCCACATGGATGG + Intergenic
986928971 5:12794966-12794988 GCCCTTCATGGCTGCTGTGCCGG + Intergenic
991499200 5:67259367-67259389 GCCCCTCATCACCACCTTGAAGG - Intergenic
991690158 5:69217816-69217838 GCCCATCATGACCCCCGAGAAGG - Exonic
992024072 5:72653681-72653703 GCCCTGCAGGGCCTCCCTGAAGG - Intergenic
995070267 5:107913214-107913236 GCCCTTCATGGCTACTGTCTTGG - Intronic
1002088923 5:176793180-176793202 GCCCTTCGTGGCCACGTTGCAGG + Intergenic
1002423406 5:179162286-179162308 CGCCTTCCTGGCCACCATGAAGG + Intronic
1003899542 6:10641393-10641415 GCCCTTCAGTGTCACCCTGATGG + Intergenic
1006116747 6:31779691-31779713 ACCCTTCATGCCCTTCGTGACGG - Exonic
1006932237 6:37695396-37695418 GCCTTTCCTGGCCTCTGTGAGGG + Intronic
1014075561 6:117230753-117230775 GCCCTGCAAAGCCACAGTGAAGG - Intergenic
1015786514 6:136924242-136924264 GGCCACCATGCCCACCGTGATGG - Exonic
1018366370 6:163123908-163123930 GCACATCTTGGCCACTGTGAAGG + Intronic
1019268520 7:132566-132588 GGCCTCCATAGCCATCGTGAAGG + Intergenic
1020803589 7:12761256-12761278 GCCCTTTATGGACTCCTTGAGGG - Intergenic
1022403073 7:30059982-30060004 GACCGTCTTGGCCAACGTGATGG + Intronic
1026221639 7:68403138-68403160 AACCTTAATGGCCACTGTGATGG + Intergenic
1026253597 7:68691612-68691634 TCTCTTCATGGCCACCTGGATGG - Intergenic
1026601989 7:71784865-71784887 GAGCTTCATAGCCACCATGATGG + Exonic
1032791484 7:135246226-135246248 GTCCTTCATGGCCCCCAGGAAGG + Intronic
1035670454 8:1412980-1413002 GCCCTTCCTGACCACAGTGTGGG + Intergenic
1039031164 8:33311159-33311181 GGTCTTCATGGCTACCCTGAAGG - Intergenic
1052765058 9:32632691-32632713 GCCCTTCATGGCAGCAATGAAGG + Exonic
1054820441 9:69516155-69516177 GTCCTTGATGGCCAGCGAGATGG + Exonic
1055032487 9:71784562-71784584 GTCACTCATTGCCACCGTGAGGG + Intronic
1057225916 9:93293038-93293060 GACCTTCATGCCCACCCTGCTGG - Exonic
1061630530 9:131869511-131869533 GCCCTTCCTGGCCTCCGCCAAGG - Intronic
1061800710 9:133112195-133112217 GGCCTGCCTGGCCACCGTGCAGG + Intronic
1203790154 EBV:147079-147101 CCCTTTCCTGGCCAACGTGAGGG + Intergenic
1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG + Intronic
1189452765 X:41154399-41154421 GCCCTCCTTGGCAACCATGAGGG - Intronic
1190711940 X:53077772-53077794 GAAGGTCATGGCCACCGTGATGG + Exonic
1192470285 X:71392600-71392622 GCCCTTCATGGCAGCAATGAAGG - Exonic
1192559394 X:72115759-72115781 TCCCTTCCTGGCCACTGTAAGGG + Intergenic
1195080136 X:101362791-101362813 CCCCTCCTTGGCCACCCTGAAGG + Intronic
1196686470 X:118514574-118514596 GCCCTTCATGTCCACCAGTAAGG + Intronic
1200116585 X:153772226-153772248 GCTCTTAATGGCCACCCGGACGG - Exonic