ID: 1187990989

View in Genome Browser
Species Human (GRCh38)
Location X:24872097-24872119
Sequence GTTGTAATTAGACCAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187990987_1187990989 21 Left 1187990987 X:24872053-24872075 CCGGTGGAAATGTTGATAAATAT 0: 1
1: 0
2: 5
3: 30
4: 349
Right 1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG 0: 1
1: 0
2: 2
3: 14
4: 223
1187990986_1187990989 22 Left 1187990986 X:24872052-24872074 CCCGGTGGAAATGTTGATAAATA 0: 1
1: 0
2: 1
3: 33
4: 236
Right 1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG 0: 1
1: 0
2: 2
3: 14
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187990989 Original CRISPR GTTGTAATTAGACCAAAAAA AGG Intronic
900375035 1:2350209-2350231 GCTGTAATTTAACCAAAATAGGG + Intronic
901658086 1:10782045-10782067 GTTGTAATTCTGCCAAAACAAGG + Intronic
901888822 1:12244170-12244192 ATTGTAAAAATACCAAAAAATGG + Intronic
909575698 1:77173629-77173651 GTTTTAATTAATGCAAAAAAAGG + Intronic
909580865 1:77233063-77233085 ACTGCAAATAGACCAAAAAAGGG - Intergenic
910593873 1:88957584-88957606 GTTTAAATAAGACCAAAAAATGG - Intronic
911669269 1:100590065-100590087 GTTATAATTTTACCAAGAAAGGG + Intergenic
912116534 1:106414112-106414134 GTTGTAATTAAATCATAAATTGG - Intergenic
915713895 1:157926080-157926102 GTTGCAATTATACCAAGCAATGG + Intergenic
917086823 1:171312077-171312099 GTTGTCATGAGACCTAGAAAGGG - Intergenic
917620271 1:176788436-176788458 GGTGTAATGAGACTAGAAAATGG + Intronic
920922759 1:210311745-210311767 GTTGTGATCAGAACAGAAAAGGG + Intergenic
922389322 1:225123380-225123402 GTAGAAATCAGACCAAATAAAGG - Intronic
924373007 1:243374695-243374717 ATTGTACTTCGACCAAAAAAGGG + Intronic
924429743 1:243986800-243986822 GTTGAAATTACACATAAAAAAGG - Intergenic
924705381 1:246497329-246497351 TTTTGAATTAGACCAAAAAAGGG - Intronic
1063718705 10:8556504-8556526 TTTGTAATTATTCCAATAAATGG - Intergenic
1064341315 10:14488289-14488311 GTTGTAGCTAAACCACAAAAGGG - Intergenic
1064355753 10:14616446-14616468 GCTGTAATCACACCAAGAAATGG + Intronic
1065353800 10:24819426-24819448 ATTGTAATCAGATCAGAAAATGG + Intergenic
1066092244 10:32034845-32034867 GATGTAATTGGAGGAAAAAAAGG + Intronic
1067660293 10:48232278-48232300 GTTGTTTTCAGACCAAAAAAGGG - Exonic
1069177169 10:65306423-65306445 GTTGTTTTAAGACCAAAAATGGG + Intergenic
1072170617 10:92857372-92857394 ATTGTAATAACACAAAAAAAGGG - Intronic
1078567272 11:12426969-12426991 GATTTATTTGGACCAAAAAAAGG + Intronic
1079051220 11:17161944-17161966 GTTTTATGTAGACCAAAATAGGG - Intronic
1079630945 11:22674480-22674502 GTTTTAAATAGCCCAAACAATGG + Intronic
1079847024 11:25485699-25485721 GTTGTAATCAAACTAAAAAGGGG + Intergenic
1079944362 11:26723250-26723272 ATTTGAATTAGACCAAAGAAAGG + Intronic
1080228798 11:29992568-29992590 GTTGTACTTAGAGGACAAAAAGG - Intergenic
1081271699 11:41092730-41092752 GTTGTAGTTAGACTAAAAGCAGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081699291 11:45142636-45142658 CTTGTCAGTAGAGCAAAAAATGG + Intronic
1084351224 11:68601211-68601233 GTTATAAACAGACCAAAAAAAGG - Intronic
1086128759 11:83378763-83378785 GTAGTAATTAAACTAAAACAAGG - Intergenic
1086345847 11:85895348-85895370 GTTGCAACTGGACCAAAAGAAGG + Exonic
1087897967 11:103608936-103608958 CTTGTTATTAGAACAAAGAATGG + Intergenic
1088830849 11:113535509-113535531 GTTGTAAACATACGAAAAAAAGG + Intergenic
1092862479 12:12730796-12730818 GTTGTATTTAGCCCAATACATGG + Intronic
1095197099 12:39332816-39332838 GTTGTACTTAAATGAAAAAATGG - Intronic
1095851491 12:46812787-46812809 GTAGTAATTACACTTAAAAAGGG + Intronic
1097726590 12:63081909-63081931 ATTGTAATTAGAGCAAACATAGG + Intergenic
1098308449 12:69124499-69124521 GGTTTAATCACACCAAAAAAAGG - Intergenic
1099567202 12:84267314-84267336 ATTTTAATTAAACCAAAAAAAGG - Intergenic
1099766457 12:86993142-86993164 CTTGTAATTAGACCAAGGATGGG - Intergenic
1103021596 12:117538991-117539013 TTTGTCATTAGACCTAAGAATGG - Intronic
1104485317 12:129146752-129146774 GTTGTTATTAGTCCCAGAAAAGG - Intronic
1105684324 13:22763379-22763401 GTTGTAAGTAGAATAATAAATGG + Intergenic
1105791279 13:23801863-23801885 GTTGTAAGTAGTTAAAAAAAAGG - Intronic
1105801369 13:23905453-23905475 GTTTTAATAAGGCCATAAAAGGG - Intergenic
1108377881 13:49830158-49830180 GTGGTGATCAGACCACAAAATGG + Intergenic
1109787662 13:67201630-67201652 GTTTTAATTACACAAAAAATTGG - Intronic
1110001361 13:70206435-70206457 GTGATCATTAGACCAAAAATTGG - Intergenic
1110260182 13:73475901-73475923 GGTGTATTTATACCAGAAAAGGG - Intergenic
1110465270 13:75793162-75793184 TTGGTTATTAGTCCAAAAAAGGG + Intronic
1111205449 13:85002662-85002684 ATTGTTATTAGATCGAAAAATGG + Intergenic
1112540205 13:100302820-100302842 GTTGAAAATAGACCTATAAATGG + Intronic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1114956406 14:27825557-27825579 ATTGTAAATTGCCCAAAAAAGGG - Intergenic
1117223511 14:53631781-53631803 GTTTTTTTTAGGCCAAAAAAGGG - Intergenic
1117786850 14:59294672-59294694 GTTGTGATTGGAACTAAAAAAGG - Intronic
1117949859 14:61071809-61071831 GTTGTAATTAACCCAAAGACAGG + Intronic
1124732582 15:32211772-32211794 GTTGTGACTAAACCATAAAAGGG - Intergenic
1125356564 15:38822715-38822737 GTTGGAATGAAACCAAAATAAGG - Intergenic
1126528612 15:49687088-49687110 TTTGTAATTAGTCCCAAACATGG - Intergenic
1127490771 15:59460693-59460715 TTTGAAATGAGACCAATAAAAGG + Intronic
1127610662 15:60632932-60632954 GTTTAAATTTGATCAAAAAAGGG + Intronic
1129540712 15:76345668-76345690 GTAGTAATGAGAGCAAGAAAGGG + Intergenic
1129975421 15:79817313-79817335 TTTGTCAAAAGACCAAAAAAGGG + Intergenic
1130422240 15:83759108-83759130 TTTCTAATTAAAACAAAAAAAGG - Intronic
1131230835 15:90658190-90658212 TTTGTAATTAAAGCCAAAAAGGG + Intergenic
1131231280 15:90661253-90661275 TTTGTAATTAAAGCCAAAAAGGG - Intergenic
1135841049 16:25876584-25876606 GTTCTAATTAGTCAAGAAAATGG + Intronic
1136448440 16:30338176-30338198 GTTGTACTAAGAATAAAAAAGGG - Intergenic
1140124219 16:72106757-72106779 TTTTTAATTGGAACAAAAAAGGG - Intronic
1140519516 16:75569206-75569228 GAGGAAATCAGACCAAAAAATGG - Intronic
1141316482 16:82967314-82967336 GTTGTGATTAGAGCTATAAAGGG - Intronic
1142821334 17:2470332-2470354 GTATTAAATAGACCAATAAAAGG + Intronic
1143946142 17:10594089-10594111 GTACTAAATAGACCACAAAAAGG - Intergenic
1150582592 17:66488620-66488642 GTTGAAATTAGAGAAAAAGAAGG + Intronic
1151276666 17:73039558-73039580 TTAGGCATTAGACCAAAAAATGG - Intronic
1154127354 18:11703689-11703711 AATGTCATTAGAGCAAAAAACGG - Intronic
1155707085 18:28829378-28829400 GTTGTAATTATTCCAGAACAGGG + Intergenic
1157088567 18:44607864-44607886 GTTGTACTTAAAACAAAAGAAGG + Intergenic
1157343323 18:46800226-46800248 GTTGTTATTCGGCCATAAAATGG + Intergenic
1157444520 18:47734827-47734849 GTTGCCATAAGACCAGAAAATGG - Intergenic
1158059778 18:53325751-53325773 GTTGTAATTATTACAAAATATGG + Intronic
1158388844 18:57026567-57026589 TTTGTAATTAGTTCAAGAAAAGG - Intronic
1159634825 18:70792154-70792176 TTTTTAATTAAACCACAAAATGG - Intergenic
925236001 2:2277742-2277764 ATTGTAATTATAGAAAAAAATGG + Intronic
925311695 2:2889194-2889216 TTTGTAATGAAACCTAAAAATGG - Intergenic
932138429 2:69253065-69253087 GTTTTAATTAGAAAAGAAAATGG + Intergenic
932929768 2:76020713-76020735 GTTGTGATGAAACAAAAAAATGG + Intergenic
933273746 2:80261787-80261809 GTTGGATTTAGACTAATAAATGG - Intronic
935283622 2:101543383-101543405 CAACTAATTAGACCAAAAAATGG - Intergenic
935665465 2:105508356-105508378 GTTGTGTTTAAACCAAAAAAGGG + Intergenic
938657897 2:133453559-133453581 GTTGGAATTTGACAAAATAAGGG + Intronic
939893494 2:147764989-147765011 AATGGAATTAGACAAAAAAATGG - Intergenic
941122351 2:161545409-161545431 GTTGTCATTTGACCAGAGAATGG + Intronic
942755425 2:179335897-179335919 ATTATAATTAGACCACAAGAAGG + Intergenic
944097678 2:195987607-195987629 ATGGTAATTACACCAAAATATGG - Intronic
945889762 2:215417291-215417313 GTTGAGATGATACCAAAAAAAGG + Intronic
946085067 2:217162695-217162717 TTTATAATTTGACCACAAAAAGG - Intergenic
947035370 2:225847704-225847726 GTTGAAATGAGAACAAAAGATGG - Intergenic
947888239 2:233593441-233593463 GTTGTGTTTATACCACAAAAGGG + Intergenic
947894469 2:233656675-233656697 GTTGTGTTTAAACCACAAAAGGG + Intronic
948851092 2:240706351-240706373 GTTGTATTGAAACCAGAAAAAGG + Intergenic
1168961153 20:1871005-1871027 GTAGCAATTAAACCAAGAAAGGG + Intergenic
1169175396 20:3507497-3507519 GTTGTAATTAGAACTCCAAAAGG + Intronic
1169762783 20:9114564-9114586 GTAGTAATTAGAAGGAAAAAGGG - Intronic
1170181922 20:13541006-13541028 GTTGTAACTATAAGAAAAAAGGG + Intronic
1170563014 20:17573461-17573483 ACTTTAAATAGACCAAAAAAAGG - Intronic
1170795771 20:19545625-19545647 CTTGTGATTAGACCAGAAGATGG - Intronic
1177354695 21:19993857-19993879 GCACTAATTAGACCACAAAAAGG + Intergenic
1179336414 21:40460380-40460402 GTTATTATTAGACAAAAATATGG + Intronic
1179578162 21:42320579-42320601 GTTGTAATTAAACTAAGATAAGG + Intergenic
1180567658 22:16688675-16688697 CATAAAATTAGACCAAAAAATGG + Intergenic
1183767241 22:39889750-39889772 GTTGTATTTTTACCAAAAAGAGG - Intronic
1184284683 22:43463581-43463603 TTTTTAATTTGACCAAAAGAGGG - Intronic
949591809 3:5502476-5502498 GTACTAAATAGACCACAAAAAGG + Intergenic
949917560 3:8976463-8976485 CTTGCAATTAAAACAAAAAAGGG - Intergenic
951073657 3:18363436-18363458 GTTATAATTTTACCAATAAAAGG + Intronic
952697302 3:36282120-36282142 GTTGGAAATAGACCTAAGAATGG - Intergenic
952704983 3:36368102-36368124 GTTGCACTGAAACCAAAAAAAGG - Intergenic
952739472 3:36721692-36721714 ATTGTGATTAGAACAAAGAAGGG + Intronic
952982758 3:38751500-38751522 ATTGTAAAGAGACCAATAAATGG - Intronic
954311965 3:49776554-49776576 GTACTAAATAGACCAAGAAAAGG + Intronic
963485948 3:145934651-145934673 GTTGGACTTAAACCAAAATAGGG + Intergenic
963878245 3:150500749-150500771 GTAGAAATTAGACAAAACAAGGG + Intergenic
964066386 3:152584886-152584908 GTTGAAATTAGGTCTAAAAATGG + Intergenic
965346921 3:167562435-167562457 GTTGTAATTTCAGGAAAAAAAGG - Intronic
965854894 3:173075146-173075168 GTTGAAATTATAAAAAAAAAAGG + Intronic
969640098 4:8392595-8392617 ATTGTAATTAGAAATAAAAAAGG + Intronic
970140829 4:12980202-12980224 TTTGTAATTAGGCAAAAATAGGG - Intergenic
971212074 4:24628455-24628477 TTTGTAATTTGAGAAAAAAAAGG + Intergenic
972096576 4:35354488-35354510 CGTGTATTTAGACCAAATAAAGG + Intergenic
972836626 4:42878432-42878454 ATTGCAATTCCACCAAAAAAGGG + Intergenic
973174091 4:47182685-47182707 GTTCAAATCAGACAAAAAAAGGG + Intronic
973343549 4:49030370-49030392 CCTGTAATCAGACTAAAAAAGGG - Intronic
974364099 4:60923502-60923524 GGTGGAATTCGACCAAGAAAAGG - Intergenic
974402186 4:61421913-61421935 GATGTTTTTAGACCAAAAAGCGG - Intronic
974543657 4:63272182-63272204 GTTGAAACTATTCCAAAAAATGG - Intergenic
979885573 4:126024185-126024207 GTTGTTAATAGACAAAACAATGG + Intergenic
980204502 4:129700174-129700196 GTTGTCATCACACTAAAAAAAGG + Intergenic
980502225 4:133671550-133671572 GTCGTAAATAGAACAAAAAGAGG + Intergenic
980664293 4:135908687-135908709 GATGAAATAAGACCAAAAAAAGG - Intergenic
980957149 4:139440919-139440941 GTTGTTTTAAGACCAAAAAAAGG - Intergenic
981565737 4:146099477-146099499 GTTGGACTTTGACCAAATAAAGG - Intergenic
982440332 4:155427547-155427569 GATGTAATTATATCAAAAAAGGG - Intergenic
983391481 4:167136371-167136393 GTTGTACACAGCCCAAAAAAAGG - Intronic
983420829 4:167514185-167514207 ATAGTTATTAGACCAAAAGATGG + Intergenic
983486303 4:168334897-168334919 GTTGTTAATAGATGAAAAAATGG + Intergenic
983861857 4:172717243-172717265 ATTGGAATTATACCAACAAAAGG + Intronic
985946539 5:3189103-3189125 TTTATCATTAGACCCAAAAAAGG - Intergenic
987506053 5:18774397-18774419 AATGTAATCAGACCAAAATAGGG - Intergenic
987615248 5:20265950-20265972 GATCTAAATAAACCAAAAAAGGG + Intronic
987985739 5:25143258-25143280 GTTGTAATTAGACTAAGAAATGG - Intergenic
989399510 5:40993746-40993768 GTTGTAAAGATACCTAAAAATGG - Intergenic
989759115 5:44990507-44990529 TTTTTAATTAGAGAAAAAAAAGG + Intergenic
990929336 5:61070370-61070392 GTAGTATTTATTCCAAAAAAAGG + Intronic
991986579 5:72293393-72293415 GTTTTGATTAAAGCAAAAAATGG + Intronic
992711110 5:79457425-79457447 GTGCTAAATAGACCATAAAAAGG - Intronic
994134094 5:96265026-96265048 GTTGGAAATATACCTAAAAATGG + Intergenic
994284187 5:97943937-97943959 GTTGTAAATAGAATAAAGAAAGG - Intergenic
994404510 5:99327630-99327652 ATTGCTATTAGACCAATAAATGG - Intergenic
994594834 5:101819189-101819211 GTTGCAACTAGAACACAAAAAGG + Intergenic
994794257 5:104274679-104274701 ATTGTAATGAGAACAGAAAATGG + Intergenic
996345836 5:122487382-122487404 TTTCTAATCAGACCAAACAAAGG - Intergenic
996737892 5:126774580-126774602 GAGGAAATTAGACCAAAAGAAGG - Intergenic
998723292 5:144978108-144978130 GTTGGAATTAGGTCATAAAATGG - Intergenic
1001015292 5:168135526-168135548 GTTATAATCAGACCCACAAAAGG + Intronic
1001224879 5:169935285-169935307 GCTTTAACTCGACCAAAAAAAGG + Intronic
1003389028 6:5697087-5697109 TTTGTAAATAGAAAAAAAAAAGG - Intronic
1005192138 6:23236336-23236358 TTTGTATTAACACCAAAAAAGGG - Intergenic
1005335286 6:24790034-24790056 GATGCAATGAGACCAAATAAAGG + Intergenic
1005403187 6:25456531-25456553 GTTATCAGTAGGCCAAAAAAAGG + Intronic
1006226728 6:32544165-32544187 CTTATAAGTAGAGCAAAAAACGG - Intergenic
1006226760 6:32545061-32545083 CTTATAAGTAGAGCAAAAAACGG + Intergenic
1007496573 6:42263862-42263884 CTTGTAATCAGTCCAAAAGAAGG + Intronic
1007645350 6:43375974-43375996 ATTGTAATTAGACAGAACAATGG + Intergenic
1008774529 6:55021107-55021129 GTTGCAATAAGACAAGAAAAAGG - Intergenic
1008810280 6:55488513-55488535 GTACTAATTTAACCAAAAAAAGG - Intronic
1009578136 6:65493753-65493775 GTTGTAATAAGCTCAATAAAAGG - Intronic
1010581909 6:77609778-77609800 GAAGGAATTAGTCCAAAAAATGG + Intergenic
1010659117 6:78548437-78548459 GTTGTGTTTAGACTGAAAAAGGG + Intergenic
1011267074 6:85533199-85533221 ATTCTAATTAGCCCACAAAATGG + Intronic
1011573319 6:88763923-88763945 GTTGAAATCAGAACAAAAGATGG + Intronic
1012078778 6:94728526-94728548 GTTGTAAGGATACCCAAAAATGG - Intergenic
1013849209 6:114493829-114493851 GTAGAAAGTAGACAAAAAAAAGG - Intergenic
1014021034 6:116590051-116590073 CTTGTAATAAGAATAAAAAATGG + Intronic
1015547182 6:134373340-134373362 GTTGTAGGGAGACAAAAAAAAGG + Intergenic
1016812924 6:148278375-148278397 GCTGTAATGAGAAAAAAAAATGG - Intronic
1017358848 6:153542345-153542367 GTTGTATCTAAACCATAAAAGGG - Intergenic
1017626274 6:156352208-156352230 GTTGAAGGTAGACCAAAAAAGGG - Intergenic
1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG + Intronic
1023152866 7:37218516-37218538 CTTACTATTAGACCAAAAAATGG - Intronic
1023221637 7:37925099-37925121 GTTGGAATTAGAAAATAAAATGG - Intronic
1023258256 7:38333025-38333047 GTTGTAATAAAACTGAAAAAAGG + Intergenic
1023565134 7:41516556-41516578 GATGTAATAACACAAAAAAAGGG - Intergenic
1028534257 7:91874275-91874297 GTTGTTATTGGACCGAAAAAAGG + Exonic
1030920621 7:115380948-115380970 GATGTCATTAAACCTAAAAAGGG + Intergenic
1032313201 7:130808043-130808065 GCTGTAAATAGAACAAAAAGAGG + Intergenic
1033502729 7:141968582-141968604 GTTTATATTAGAACAAAAAAAGG + Intronic
1038977526 8:32716719-32716741 GTTATATTTAAACCAAAAAAGGG - Intronic
1040664328 8:49614447-49614469 GTAGTAAATAAGCCAAAAAAAGG + Intergenic
1041495907 8:58485063-58485085 GTTTTAATTTGACTAAGAAATGG - Intergenic
1041918746 8:63161091-63161113 ATTGTAATTATACCAAGATATGG - Intergenic
1042807533 8:72787846-72787868 GTAGTAATTAAAGCAAAAATTGG - Intronic
1046652122 8:116847691-116847713 GCTGAAATAAAACCAAAAAAGGG + Exonic
1046861339 8:119094990-119095012 GTTCTAATCACAGCAAAAAATGG + Intronic
1047148936 8:122239037-122239059 TTTGTAATTACACCAACATATGG - Intergenic
1047645416 8:126864935-126864957 GTTGTAATTAGAGCATAAAATGG - Intergenic
1048065439 8:130962939-130962961 GTTTTAATTAGACAATAAATAGG - Intronic
1048296219 8:133216295-133216317 CATGTAATTAGACCAGAACAAGG + Intronic
1048523681 8:135180997-135181019 ATTGTGAGTAAACCAAAAAAGGG - Intergenic
1050721143 9:8591308-8591330 GTTGTGGGTAGACCAAATAATGG - Intronic
1054893836 9:70284598-70284620 GTTATAAATAGACAAAACAAAGG - Intronic
1054967142 9:71042192-71042214 GTTGTTATTTGAAAAAAAAAAGG + Intronic
1055214531 9:73842444-73842466 GTTGTAATTTTACCAAAATTGGG + Intergenic
1055686826 9:78784033-78784055 GTTGTTATGAGAACAAGAAAGGG + Intergenic
1056058451 9:82855137-82855159 ATTGCAATTAGACCAATTAATGG - Intergenic
1057742590 9:97725027-97725049 TGTGTGATTAGAACAAAAAAAGG + Intergenic
1058446365 9:105058576-105058598 GTTGTGTCTAGACCACAAAAAGG - Intergenic
1058619250 9:106864903-106864925 GTTGTAACTCCACCAGAAAATGG + Intronic
1059010101 9:110448563-110448585 GTTGTAATGACACCAAACACAGG - Intronic
1061527975 9:131183734-131183756 TTTGTAATTAGAAAAACAAAAGG - Intronic
1185943644 X:4349659-4349681 GTTGGAATTAGACTCAGAAATGG - Intergenic
1187541910 X:20205019-20205041 GTGATAATTTGACCATAAAAAGG - Intronic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1188090970 X:25964902-25964924 GTTGAAATTATATAAAAAAATGG + Intergenic
1188640963 X:32504161-32504183 ATTGTAATTAAAACAAAAGAAGG - Intronic
1192850439 X:74950190-74950212 GTTCTCATCACACCAAAAAAAGG - Intergenic
1192927588 X:75771620-75771642 ATTGTAAATAGACCAAAAACAGG - Intergenic
1194728300 X:97424955-97424977 ATTGTAATTAGATAAAAAGATGG - Intronic
1196373747 X:115008103-115008125 GTTGCAACTAGATCAAATAATGG - Intronic
1196905297 X:120425533-120425555 CTTGTAATTAAGTCAAAAAATGG - Intergenic
1197077607 X:122372086-122372108 GTAATAATTTGATCAAAAAATGG - Intergenic
1199203957 X:145125318-145125340 GTTGTAAAGATACCAGAAAATGG - Intergenic
1200364124 X:155643681-155643703 GTTGTTATTAGCTTAAAAAATGG - Intronic
1201728208 Y:17177878-17177900 GTTGGAATTAGACTCAGAAATGG - Intergenic