ID: 1187996155

View in Genome Browser
Species Human (GRCh38)
Location X:24929127-24929149
Sequence TAGCCAACCCAATTTGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187996155_1187996161 27 Left 1187996155 X:24929127-24929149 CCTGCACCAAATTGGGTTGGCTA 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1187996155_1187996158 14 Left 1187996155 X:24929127-24929149 CCTGCACCAAATTGGGTTGGCTA 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1187996158 X:24929164-24929186 TAAGACCCAGCTAGGATCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 94
1187996155_1187996157 6 Left 1187996155 X:24929127-24929149 CCTGCACCAAATTGGGTTGGCTA 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1187996157 X:24929156-24929178 TTCATCATTAAGACCCAGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187996155 Original CRISPR TAGCCAACCCAATTTGGTGC AGG (reversed) Intronic
901300415 1:8196321-8196343 TAGCCAACCCTATTTTGCCCAGG - Intergenic
1063743548 10:8853739-8853761 AAACCAAACCAGTTTGGTGCTGG - Intergenic
1078886769 11:15508096-15508118 TAGCAAACTCAATTTTCTGCTGG - Intergenic
1079260861 11:18879180-18879202 CAACCGACCCAAGTTGGTGCAGG - Intergenic
1080513255 11:32996391-32996413 TAGCCAAAACAATATGGTACTGG - Intergenic
1099251186 12:80256955-80256977 TAGCAAAACCAATTTAGTTCTGG - Intronic
1100990690 12:100248306-100248328 TTGCCCAGACAATTTGGTGCTGG + Intronic
1101375629 12:104168946-104168968 TGGCCAACCAAACTTGGAGCTGG + Intergenic
1108800336 13:54087566-54087588 TAGCCAAAACAATCTGGTACTGG - Intergenic
1111510112 13:89250215-89250237 TAGCCCACCCCATTTGGTCATGG - Intergenic
1117210069 14:53487907-53487929 TAGCCAAACCAATATGGTACTGG + Intergenic
1120603163 14:86537796-86537818 TAGCTAACCCTATTTTTTGCTGG - Intergenic
1123501334 15:20884454-20884476 TAGCTAAAGGAATTTGGTGCTGG - Intergenic
1123558587 15:21458159-21458181 TAGCTAAAGGAATTTGGTGCTGG - Intergenic
1123594816 15:21895434-21895456 TAGCTAAAGGAATTTGGTGCTGG - Intergenic
1126200133 15:45976072-45976094 TAGCCAACCCCACTTGTGGCTGG + Intergenic
1202966935 15_KI270727v1_random:185312-185334 TAGCTAAAGGAATTTGGTGCTGG - Intergenic
1144518016 17:15932821-15932843 TAATCAACACAATGTGGTGCTGG - Intergenic
931484970 2:62681599-62681621 TAGCCAACCCTGTTTTGTTCAGG + Intronic
933264989 2:80172160-80172182 TAGCCAAATCATTTTAGTGCAGG - Intronic
936081935 2:109438232-109438254 TTGCCCACCCAAGTGGGTGCAGG + Intronic
939508797 2:143081418-143081440 TAGCTACCCCAGTTAGGTGCAGG + Intergenic
941272638 2:163449863-163449885 TTCACAACCGAATTTGGTGCTGG - Intergenic
947000162 2:225445709-225445731 TGAGCAGCCCAATTTGGTGCTGG + Intronic
1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG + Intergenic
1172496921 20:35393997-35394019 TAGCCAACCAAATTGTGTGATGG - Intronic
1177594704 21:23223188-23223210 TAGCCAGTCCAATTTGGTAACGG - Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
954384510 3:50237165-50237187 TAGCCCAGCCCACTTGGTGCAGG - Intronic
956263689 3:67374004-67374026 CAGTCAACCCAATTTGGAGGAGG - Intronic
957440989 3:80247060-80247082 AATCAAACCCAATATGGTGCTGG - Intergenic
976079501 4:81339360-81339382 TAACCAAAACAATATGGTGCTGG - Intergenic
976958513 4:90935677-90935699 TTCCCAACCCAATTTAGTCCTGG - Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
981776855 4:148378403-148378425 TATCCAAACCAATTCAGTGCAGG - Intronic
984091858 4:175385292-175385314 TAGCTAAAACAATTTGGTGAGGG + Intergenic
989776132 5:45208766-45208788 TATCCAATCCAATTTGATCCTGG - Intergenic
1009372653 6:62926491-62926513 TAGCCAACAGAATTTGGTGAAGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1018867779 6:167759163-167759185 GAGCCAACCTAATTTGCTGCTGG + Intergenic
1024376500 7:48644733-48644755 TAACCAAACCACTTTGGAGCAGG + Exonic
1029051842 7:97697730-97697752 TTGCCAAACAAATATGGTGCTGG - Intergenic
1043271658 8:78341507-78341529 TACCAGACCCAACTTGGTGCTGG + Intergenic
1045610086 8:103829582-103829604 TATCCTAACCAATTTGATGCAGG + Intronic
1045956021 8:107909031-107909053 CAGCCAACTCATTGTGGTGCTGG - Intronic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1049068371 8:140337672-140337694 TAGGCAGCCCATTTTGGTGGGGG - Intronic
1052707900 9:32015574-32015596 TAGCCAACACAGTATGGTCCTGG - Intergenic
1057242654 9:93425540-93425562 TAGTCAAAACAATATGGTGCTGG - Intergenic
1060598079 9:124860050-124860072 TAGCCTTCCCAATTTGTTGCTGG - Intronic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1200819370 Y:7566526-7566548 TAGCCACCCCAAGTGAGTGCTGG - Intergenic