ID: 1187996156

View in Genome Browser
Species Human (GRCh38)
Location X:24929133-24929155
Sequence AAATTATAGCCAACCCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187996156_1187996161 21 Left 1187996156 X:24929133-24929155 CCAAATTGGGTTGGCTATAATTT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1187996156_1187996158 8 Left 1187996156 X:24929133-24929155 CCAAATTGGGTTGGCTATAATTT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 1187996158 X:24929164-24929186 TAAGACCCAGCTAGGATCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 94
1187996156_1187996157 0 Left 1187996156 X:24929133-24929155 CCAAATTGGGTTGGCTATAATTT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 1187996157 X:24929156-24929178 TTCATCATTAAGACCCAGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187996156 Original CRISPR AAATTATAGCCAACCCAATT TGG (reversed) Intronic
904367274 1:30022170-30022192 AAGTTCTAGCCAAGACAATTAGG - Intergenic
907177955 1:52543088-52543110 AAGTTCTAGCCAACGCCATTAGG + Intronic
909966410 1:81916737-81916759 AAATAATAGCAAACATAATTGGG + Intronic
911319229 1:96392434-96392456 CACTTACAGCCAACCCATTTTGG + Intergenic
911539277 1:99138928-99138950 AAATTATAGCACATACAATTAGG + Intergenic
912089829 1:106057430-106057452 AAAATATAGCCAAACCACTAAGG + Intergenic
914394603 1:147253022-147253044 AAATTTTAGCAAAACAAATTTGG - Intronic
918279293 1:182987628-182987650 TAATTATAGCCATCCCAAAGTGG - Intergenic
919358847 1:196563996-196564018 AAGTTCTAGCCAAAGCAATTAGG + Intronic
919364413 1:196638970-196638992 AACTAATAGCCAACACAATATGG - Intergenic
919722606 1:200855282-200855304 AAGTCATAGGCAACCCACTTTGG - Intronic
920025929 1:202996164-202996186 AAATTCTAGCCAGAGCAATTAGG + Intergenic
920834622 1:209498256-209498278 AAATCCTAGCCAGACCAATTAGG - Intergenic
922736910 1:227990525-227990547 AAGTTCTAGCCAAAGCAATTTGG + Intergenic
923799927 1:237198913-237198935 AAATTATAGGCTAACCACTTTGG + Intronic
924084398 1:240435443-240435465 AAATTATAACTAATTCAATTGGG - Intronic
924759882 1:246973849-246973871 AAATTATATCCCACCCATGTAGG + Intronic
1063843376 10:10097597-10097619 AAATGATAGCCAACACAAACTGG + Intergenic
1064039825 10:11951422-11951444 AAAGTATAGCCATACCAATCTGG - Intronic
1064517152 10:16163583-16163605 AAGTTATAGTCAAAACAATTAGG - Intergenic
1066225517 10:33379024-33379046 AATTTTAAGACAACCCAATTAGG + Intergenic
1067353510 10:45500657-45500679 AAGTTCTAGCCACCACAATTAGG + Intronic
1067744422 10:48924649-48924671 AAATTAAAGTCAAACCAACTGGG - Intronic
1067819557 10:49516225-49516247 AACTTATAGCCAAACCGAATGGG + Exonic
1069673254 10:70228539-70228561 TAATTCAAGCCAACCCAATGGGG + Intronic
1070895303 10:79978835-79978857 AAATCCTAGCCAGCTCAATTAGG + Intronic
1072725325 10:97809272-97809294 AAAATAAAGCCAACCTTATTGGG - Intergenic
1076854161 10:133107344-133107366 AAGTTGTAGCCAGCACAATTAGG - Intronic
1077427225 11:2487875-2487897 AAATTCTAGCCAGAGCAATTTGG - Intronic
1079539173 11:21551345-21551367 AAATTCTGGCCAAGGCAATTAGG - Intronic
1080111313 11:28571098-28571120 AAATTAGAGACAAACCAATTAGG - Intergenic
1082295942 11:50441314-50441336 CACTTACAGCCAACCCAAATGGG + Intergenic
1084604811 11:70166349-70166371 AAAATAAAGCCACCCCATTTTGG + Intronic
1085235424 11:75010730-75010752 TAACTATAGAAAACCCAATTAGG - Exonic
1091359819 11:134969450-134969472 AAATTCTAGCCAGCGTAATTAGG + Intergenic
1091476050 12:774002-774024 AAATAATGGCCATCTCAATTAGG - Intronic
1091894722 12:4091980-4092002 AAATTATAGGCAACCAGCTTTGG - Intergenic
1092393384 12:8101926-8101948 AAATACTAGCCAACTGAATTTGG + Intergenic
1094584221 12:31762622-31762644 AAGTTCTAGCCAAGGCAATTAGG + Intergenic
1096238597 12:49946835-49946857 AAATTATAGGCAAAACAAATTGG - Intergenic
1098673428 12:73258422-73258444 AAATTCTAGCCAAAACAGTTAGG + Intergenic
1098727705 12:73989467-73989489 AAATTAGAGACAAACTAATTTGG + Intergenic
1100765377 12:97858844-97858866 AAATCCTAGCCAGCTCAATTAGG + Intergenic
1102724880 12:115053237-115053259 AAATTCTAGCCAGAGCAATTAGG - Intergenic
1107089863 13:36466837-36466859 CATTTATAGCCAACTCATTTGGG - Intergenic
1108122445 13:47203851-47203873 AAGTTCTAGCCAAAGCAATTAGG + Intergenic
1108371327 13:49772176-49772198 ATTTTCTAGCCAACACAATTAGG - Intronic
1108841173 13:54617063-54617085 AATTTTTATCCAACACAATTAGG + Intergenic
1109581390 13:64341832-64341854 AAATCATAGCCAGAGCAATTAGG - Intergenic
1111164096 13:84434964-84434986 AAATTCTAGCCAGAGCAATTAGG - Intergenic
1115683215 14:35765305-35765327 AAATAAAAGCCAAAGCAATTTGG - Intronic
1115840088 14:37460496-37460518 AAATTCTAGCCAAAGCAATCAGG + Intronic
1116377470 14:44221580-44221602 TAATTATAGCCATTCTAATTGGG - Intergenic
1116898270 14:50338159-50338181 CTATTATGGCCAACCCAAATGGG - Intronic
1117306805 14:54485848-54485870 CATTTATAGCCAACTCATTTTGG + Intronic
1117940128 14:60954720-60954742 AAGTTATAGCCAGAGCAATTAGG - Intronic
1118313699 14:64711005-64711027 AAATTTTAGCCAACCTGACTGGG - Intronic
1119570958 14:75671879-75671901 AAATTCTAGCCAGAACAATTAGG - Intronic
1120428530 14:84382591-84382613 AAATTCTAGCCAGGGCAATTAGG + Intergenic
1120606132 14:86580850-86580872 TAATTATGGCCAACCAAAATTGG + Intergenic
1121167531 14:91820597-91820619 AGATTCTAGCTAAGCCAATTAGG + Intronic
1121248179 14:92479193-92479215 AGATTATAGCCAAGAAAATTAGG - Intronic
1124215255 15:27801965-27801987 AAAGTATAACCAATGCAATTAGG + Intronic
1124357421 15:29006071-29006093 AAATTCTAGCCAGAACAATTTGG + Intronic
1124560009 15:30763491-30763513 AAATTTTAGCAAATCGAATTTGG + Intronic
1126550368 15:49922261-49922283 AAACTATAGGAAACCTAATTTGG - Intronic
1128674503 15:69598709-69598731 GAACTGTAGCCAACACAATTTGG + Intergenic
1129527648 15:76230815-76230837 AAAGTATAACCAACACATTTTGG - Intronic
1130042530 15:80417432-80417454 AAATTATAACCTCCCGAATTTGG - Intronic
1130292029 15:82611110-82611132 AGATTTTAGCCAGCACAATTAGG + Intronic
1131128547 15:89877847-89877869 AAATTAAAGCCAATGCAAATGGG - Intronic
1131935478 15:97499604-97499626 AAATAGTAGCCAACACTATTAGG - Intergenic
1135962389 16:27007541-27007563 AAGTTCTAGCCAGCCCAATAAGG + Intergenic
1136097869 16:27971646-27971668 ACATTTTAGCCAAAGCAATTAGG - Intronic
1140491587 16:75341374-75341396 ACATTATAGCAAAGCCAGTTAGG - Intronic
1149213344 17:54328164-54328186 AAATTATAGACTCCCAAATTAGG - Intergenic
1149675289 17:58454472-58454494 AAATTCTAGCCAGACCAATTAGG + Intronic
1152966806 18:123908-123930 CAAGAATAGCCAAGCCAATTGGG - Intergenic
1153843557 18:9028814-9028836 AAATTATAGCCACTGCAATTAGG + Intergenic
1154495284 18:14952567-14952589 AAATTCTAGCCAGCGTAATTAGG - Intergenic
1154927181 18:20948149-20948171 CAAGAATAGCCAAGCCAATTGGG + Exonic
1155181034 18:23346908-23346930 AAATCTTAGCAAACCAAATTTGG - Intronic
1155689858 18:28606559-28606581 AAATTACAGCATACACAATTTGG - Intergenic
1156793998 18:41018140-41018162 AAGTTCTAGCCAAAACAATTAGG + Intergenic
1156860516 18:41830626-41830648 AAAAAATAGCCAATCAAATTAGG + Intergenic
1157266309 18:46225961-46225983 AAATTTTAGTGAACCCAAATAGG + Intronic
1158196387 18:54890196-54890218 AAATTTTACTCAAGCCAATTAGG + Exonic
1158905479 18:62007143-62007165 AAATAATAGCCACCCCAATGGGG - Intergenic
1159382632 18:67681680-67681702 AAATAAAAGCCATCCAAATTGGG + Intergenic
1164631152 19:29762256-29762278 AAATTACACCCAAACCAACTGGG + Intergenic
1168660471 19:58161814-58161836 AAAGGAAAGCCAACCCATTTTGG - Intergenic
928488699 2:31758564-31758586 AAATAATAACCAAACCAGTTTGG + Intergenic
928916331 2:36475582-36475604 AAATTCTAGCCAGAGCAATTAGG - Intronic
929045876 2:37788829-37788851 AAATCCTAGCCAAAGCAATTAGG - Intergenic
932279628 2:70479148-70479170 AAATTATATCCTCCCCATTTGGG + Intronic
933405788 2:81857721-81857743 AAAATATAGCCAACACAATTAGG - Intergenic
933642137 2:84775009-84775031 AAATCATAGCCAAAGCAATCAGG - Intronic
935613546 2:105052125-105052147 ACATTCTAGCCAAGGCAATTAGG - Intronic
935764649 2:106354030-106354052 TAATAATAGCCATCCTAATTGGG + Intergenic
936879109 2:117228082-117228104 AAATAAAAGCCATCCAAATTGGG - Intergenic
937962940 2:127476286-127476308 AAATCTTAGCCAAAACAATTAGG + Intronic
938984727 2:136563373-136563395 AATTTATAACCACCCCAAGTCGG + Intergenic
940668961 2:156644255-156644277 AAATTCTAGCCAGAGCAATTAGG + Intergenic
941347112 2:164383587-164383609 AAATTGTAGCCAGAGCAATTAGG - Intergenic
941628858 2:167862032-167862054 AAATGATTGCCAAGCCAATTCGG + Intergenic
941762686 2:169262232-169262254 AAATTCTGGCCAGGCCAATTAGG + Intronic
942002357 2:171661132-171661154 AAAGTATAGGCAACCCAACCCGG - Intergenic
942457843 2:176150174-176150196 AAATTGTCGCCAAGCCCATTAGG + Intergenic
942922036 2:181386176-181386198 ACATTATAGCCAGGGCAATTAGG + Intergenic
943193885 2:184718565-184718587 TAAATATAGCCAATCCAAATAGG + Intronic
945165037 2:206934473-206934495 AAAGGAAAGACAACCCAATTAGG - Intergenic
946197231 2:218041260-218041282 GAAATATAGCCAAAGCAATTTGG - Intronic
946992138 2:225345850-225345872 AATTTCTAGCCAAGGCAATTAGG - Intergenic
1168909842 20:1438932-1438954 GAATTATTTCCATCCCAATTTGG - Intergenic
1168997298 20:2142986-2143008 AAATAATAGCCAACACTAATAGG + Intronic
1169290830 20:4350255-4350277 AAATTCTAGCCAGGACAATTTGG - Intergenic
1171098821 20:22361996-22362018 AAATTATAGCCAGAGCAATTAGG + Intergenic
1174923579 20:54731732-54731754 AATTTACAGCCAACTAAATTTGG - Intergenic
1177594705 21:23223194-23223216 ATTTTATAGCCAGTCCAATTTGG - Intergenic
1177865192 21:26504470-26504492 AAATTACAGCCTAGCCAATATGG - Intronic
1178171069 21:30040418-30040440 AAAATATAGCCCACAGAATTTGG - Intergenic
1180556160 22:16577605-16577627 AGATTTTATTCAACCCAATTAGG - Intergenic
1180897183 22:19345153-19345175 AAATAAAAGGCAACCAAATTGGG + Intronic
1181661202 22:24350267-24350289 AAATTATAGACAAACCATATGGG - Intronic
1184618859 22:45658604-45658626 AAATAATAGACAAACAAATTGGG - Intergenic
949728506 3:7078633-7078655 AAATTAAAGCCAAACCATATGGG + Intronic
950367936 3:12501928-12501950 AAATTATAGGCAAAACAATAGGG - Intronic
952548925 3:34453927-34453949 AAATTTTAGCCAGAGCAATTGGG - Intergenic
953970148 3:47340991-47341013 AAATCATATCCTACCCACTTTGG - Intronic
956830690 3:73044646-73044668 AGATAATAGCCAACCCTAATGGG + Intronic
957588515 3:82163798-82163820 AAATTTTAACCAACCCAAAGGGG - Intergenic
957998368 3:87720743-87720765 AAGTTCTAGCCAAAACAATTAGG + Intergenic
958621042 3:96560606-96560628 ATATAAGAGCCAACACAATTTGG - Intergenic
959402228 3:105917046-105917068 AAATTATTGCCAGAGCAATTAGG - Intergenic
959865431 3:111263756-111263778 AAGTTCTAGCCAAAGCAATTTGG + Intronic
959947753 3:112144944-112144966 AAATGCTAGCCAAAGCAATTAGG - Intronic
959960965 3:112297079-112297101 AAATTCCAGCCAGGCCAATTAGG - Intergenic
960294896 3:115931054-115931076 AGATGATAAGCAACCCAATTGGG + Intronic
960329037 3:116334873-116334895 AAGTTATAGCCAGATCAATTAGG + Intronic
960435183 3:117617992-117618014 AAATTATAGCTCAGCAAATTTGG - Intergenic
960754374 3:120994291-120994313 AAATTCTAGCCAGAGCAATTAGG - Intronic
961557173 3:127703872-127703894 AAATAACAAACAACCCAATTAGG + Intronic
962030360 3:131593668-131593690 AAATTCTAGCCAGAGCAATTAGG - Intronic
963491469 3:146007026-146007048 AAATTACAGCCAACCCAGTGAGG - Intergenic
964303537 3:155316123-155316145 AAATAATAACCAAATCAATTTGG + Intergenic
966354211 3:179061949-179061971 AAACTATAGCCAGCTCAAGTTGG + Intronic
966369912 3:179239596-179239618 AGATTTTATTCAACCCAATTAGG - Exonic
966579456 3:181543846-181543868 AAGTTATAAACAATCCAATTAGG - Intergenic
967637327 3:191818683-191818705 AAAACATAGCCAAGGCAATTGGG - Intergenic
967699388 3:192573732-192573754 AAATAAAACCCAACCAAATTTGG + Intronic
968418494 4:461895-461917 AAATTCTGGCCAAGGCAATTAGG + Intronic
970881971 4:20943180-20943202 AAAATATAACCAACTGAATTTGG + Intronic
972369250 4:38406830-38406852 AAATAATAGCCATCCTAATGTGG + Intergenic
972878439 4:43394949-43394971 AAATAATAGCCAAGACAATGGGG + Intergenic
974336497 4:60552877-60552899 AAATTATAACCAATGTAATTTGG - Intergenic
974773927 4:66455200-66455222 AAATCTTAGCCAAACCAATCAGG + Intergenic
975686863 4:76924783-76924805 AATTTGTAGCCAAGCCAGTTGGG + Intergenic
976402660 4:84624668-84624690 AAATTATAGCAAAACCAAAGGGG - Intronic
977428238 4:96897108-96897130 AAATTATATCCAAGCTAATGTGG + Intergenic
978213085 4:106162109-106162131 AAAATATACCCATTCCAATTGGG + Intronic
979088299 4:116443639-116443661 AAATAACAGCTAACCCTATTTGG + Intergenic
980509604 4:133768169-133768191 AAATCCTAGCCAAAGCAATTAGG - Intergenic
980655729 4:135782602-135782624 AAATAATAGCCAGTACAATTAGG + Intergenic
981180685 4:141740071-141740093 AAATTCTAGCCAGAGCAATTAGG + Intergenic
982016331 4:151157398-151157420 AGATAATAGCCATCCCAACTGGG - Intronic
982318197 4:154052533-154052555 CAATAATGGCCATCCCAATTAGG + Intergenic
982804835 4:159750402-159750424 AAATTTTAGCCAGACCAATTAGG - Intergenic
982860424 4:160441810-160441832 AAATTATAACCTATCCAATGAGG + Intergenic
983529736 4:168797037-168797059 AAAGTAGAGACAACTCAATTTGG - Intronic
985165988 4:187094737-187094759 ACCTGATAGCCAACCCAAATAGG - Intergenic
986874564 5:12092578-12092600 AAATTCTACCCAACCAAATATGG - Intergenic
987191037 5:15478505-15478527 TAATTACAGCCAATCCAAATTGG - Intergenic
987865508 5:23530302-23530324 AAATTTTAGACAAAGCAATTAGG + Intergenic
988347741 5:30060423-30060445 AAAATAAAGCAAACCCAAGTAGG - Intergenic
992325874 5:75659208-75659230 AAAGTATAGCCATCCTATTTAGG - Intronic
993944783 5:94105131-94105153 AAATTTCAGCCAAAGCAATTAGG + Intronic
994701893 5:103143923-103143945 AAATTATAGCCAGAGAAATTAGG + Intronic
998127930 5:139636796-139636818 AAATTATACCCCACCCAACATGG - Intergenic
998179579 5:139927092-139927114 AAATTAGAGACAGCCCAATGTGG - Intronic
998732404 5:145094518-145094540 AAATTCTAGCCAGGGCAATTAGG + Intergenic
1000869885 5:166562823-166562845 CAATTATATTCAACACAATTGGG - Intergenic
1001218713 5:169880388-169880410 AAGACATAGGCAACCCAATTAGG + Intronic
1002412522 5:179094139-179094161 AAATTATAGCCAGAGGAATTAGG - Intergenic
1004434567 6:15577908-15577930 ATATTGTAGCCAACATAATTTGG + Intronic
1005770251 6:29062911-29062933 AAGTTATAGCCATGGCAATTAGG - Intergenic
1010694114 6:78948988-78949010 AAATTCTAGCCAATGCAATAAGG - Intronic
1010871048 6:81040018-81040040 AAATTCTAGCCACAGCAATTAGG + Intergenic
1013197901 6:107861976-107861998 AAATTCTAGCCAGAGCAATTAGG - Intergenic
1013765933 6:113574348-113574370 AAATTCTAGGCACACCAATTTGG - Intergenic
1013880867 6:114898886-114898908 AAATCATAGCCAAAGCAATCAGG + Intergenic
1014006268 6:116422423-116422445 AAATTATAGTTATCTCAATTTGG - Intronic
1014307728 6:119763427-119763449 GACCTATAGCCAACCCAACTTGG + Intergenic
1014329466 6:120042875-120042897 AAATTCTAGCCAACTCAAGAGGG - Intergenic
1014380130 6:120729610-120729632 AAATTGTAGCCAAATCAATTAGG - Intergenic
1014661320 6:124176476-124176498 AAGTTTTAGCCAAAGCAATTGGG - Intronic
1015047354 6:128791902-128791924 AAATTTTAGCCAATGCAATAAGG - Intergenic
1016664309 6:146617441-146617463 AAGTCCTAGCCAAACCAATTAGG - Intronic
1019211723 6:170411458-170411480 ACATTATAGCCAAACCATTGAGG + Intergenic
1021416823 7:20396026-20396048 AAATTATAGCCAAAGCATTGTGG + Intronic
1024390057 7:48799333-48799355 AATTTCTAGCCAAGGCAATTAGG + Intergenic
1024404050 7:48957777-48957799 AAACTAAAGATAACCCAATTAGG + Intergenic
1024687658 7:51764771-51764793 AAAGTTTAGCCAACACAATGAGG - Intergenic
1024898383 7:54287348-54287370 AAATCATAGCCAAAGCAATTAGG + Intergenic
1027582111 7:80010967-80010989 AAGTTCTAGTCAAACCAATTAGG - Intergenic
1028027354 7:85862079-85862101 AAATTAGAGCTATACCAATTAGG + Intergenic
1028671504 7:93406163-93406185 CAATTATATTCAACCCAAATAGG - Intergenic
1030490447 7:110226198-110226220 AAATTATAATCAACCAAAGTAGG - Intergenic
1032454128 7:132058902-132058924 AAAATATAGCCATTCCAAATAGG - Intergenic
1032822303 7:135535477-135535499 AAATTTTAAACAACCCAATGAGG - Intergenic
1033951105 7:146786273-146786295 AAATTATTTCCAAGACAATTGGG + Intronic
1035110438 7:156477016-156477038 AAATCCTAGCCAAAGCAATTAGG + Intergenic
1035164472 7:156977394-156977416 AAATCCTAGCCAAAGCAATTAGG - Intergenic
1037228237 8:16621735-16621757 CTATTATAGCCATTCCAATTTGG - Intergenic
1039311680 8:36323101-36323123 AAAATATAACCAACATAATTTGG + Intergenic
1039678282 8:39697368-39697390 AAATTTTAGCCAAAGCAATTAGG - Intronic
1039805948 8:40998367-40998389 AAATTCTAGCCAAAGCTATTAGG - Intergenic
1040076721 8:43244101-43244123 AAATTCTAGCCAGAGCAATTAGG - Intergenic
1040472881 8:47750458-47750480 AAATTCTAGCCAGAGCAATTAGG + Intergenic
1042074393 8:64974271-64974293 AAATTCTAGCCAGAGCAATTAGG - Intergenic
1042637172 8:70890690-70890712 AAATACTAGCAAACCAAATTTGG - Intergenic
1043314718 8:78906268-78906290 AAATTATAGCATTCCCAAGTAGG - Intergenic
1045600057 8:103703988-103704010 AAATTCTAGCAAAAGCAATTAGG - Intronic
1047839147 8:128730205-128730227 AAATTCTAGCCAAAACAATTGGG - Intergenic
1050125323 9:2351312-2351334 AAGTCATAGCCAACAAAATTGGG - Intergenic
1050510482 9:6389413-6389435 AAGTTCTAGCCAAGGCAATTAGG - Intergenic
1051449114 9:17176106-17176128 AAAATATAGCCAACACAATAAGG - Intronic
1051475626 9:17505312-17505334 AAATTCTAGCCAGCCTAATAAGG + Intergenic
1051992407 9:23167984-23168006 AAATTAAAGGCAATCCAAGTTGG + Intergenic
1053872884 9:42512129-42512151 AAATTATATCCTACCTAATAAGG - Intergenic
1053899869 9:42783785-42783807 AAATTATATCCTACCTAATAAGG + Intergenic
1054269446 9:62954623-62954645 AAATTATATCCTACCTAATAAGG + Intergenic
1055536771 9:77254994-77255016 AAATTCTAGACAGACCAATTAGG - Intronic
1057982605 9:99676204-99676226 AAGTTCTAGCCAAAGCAATTAGG + Intergenic
1058352722 9:104045259-104045281 AAGTTCTAGCCAGCACAATTAGG + Intergenic
1058922888 9:109634403-109634425 AAATTTTAGCCTAGCCAAATTGG + Intergenic
1059110046 9:111548573-111548595 AAGTTAAAGCCATCCAAATTAGG - Intronic
1059592682 9:115679080-115679102 AAATTATAGCCACCCAATTAAGG + Intergenic
1060099432 9:120825920-120825942 AAGTTATAGCCAGAGCAATTAGG - Intronic
1061454188 9:130685236-130685258 AAATAAAAGACATCCCAATTAGG - Intergenic
1061528499 9:131189804-131189826 TTATTATAGCCTACCTAATTTGG + Intronic
1186742704 X:12534718-12534740 TAAATATAGCCATCCCAAATGGG - Intronic
1186972774 X:14866724-14866746 AAATCCTAGCCAAAGCAATTAGG + Intronic
1187601377 X:20835128-20835150 AAATTCTAGCCAGCACAATAAGG - Intergenic
1187605566 X:20878726-20878748 AAGTTCTAGCCAAAGCAATTAGG + Intergenic
1187996156 X:24929133-24929155 AAATTATAGCCAACCCAATTTGG - Intronic
1189189462 X:39087210-39087232 AAGTTATAGCTAAAGCAATTAGG + Intergenic
1189659504 X:43281837-43281859 AAATCATAGCCAAAGCAATCAGG - Intergenic
1189684707 X:43551840-43551862 AAATTTTGGCCAACCCAGTGGGG - Intergenic
1189759054 X:44302192-44302214 AAATTATAGCCATTCTAATGGGG + Intronic
1190485661 X:50921899-50921921 AAGTTCTAGCCAAAGCAATTAGG - Intergenic
1190796544 X:53749872-53749894 CAATTATAGCCAAAATAATTTGG + Intergenic
1191861008 X:65666902-65666924 GAATTATAGCCAGCCCCATCAGG + Intronic
1193108814 X:77706606-77706628 CAATTAAAGACAACCCAACTGGG + Intronic
1193205041 X:78738246-78738268 AAATTATAGCCAGAGCAATTAGG - Intergenic
1194579787 X:95658091-95658113 GCATTATAGCCAACCTATTTTGG + Intergenic
1197390987 X:125864194-125864216 AAATACTAGCCAACCAAATCTGG + Intergenic
1199046987 X:143186030-143186052 AATGCATAGCCAACCCAATTCGG - Intergenic
1200010508 X:153116826-153116848 AAGTTGTAGCCAAAGCAATTAGG - Intergenic
1200029092 X:153283096-153283118 AAGTTGTAGCCAAAGCAATTAGG + Intergenic
1201193481 Y:11469582-11469604 AAATTATACCCAATCCAGGTAGG - Intergenic