ID: 1187996157

View in Genome Browser
Species Human (GRCh38)
Location X:24929156-24929178
Sequence TTCATCATTAAGACCCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187996155_1187996157 6 Left 1187996155 X:24929127-24929149 CCTGCACCAAATTGGGTTGGCTA 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1187996157 X:24929156-24929178 TTCATCATTAAGACCCAGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1187996156_1187996157 0 Left 1187996156 X:24929133-24929155 CCAAATTGGGTTGGCTATAATTT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 1187996157 X:24929156-24929178 TTCATCATTAAGACCCAGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187996157 Original CRISPR TTCATCATTAAGACCCAGCT AGG Intronic
901010687 1:6200043-6200065 TTCCTCAAAAAGCCCCAGCTTGG + Intronic
903390227 1:22958792-22958814 TTCACCATTAACAACCCGCTGGG - Exonic
903573654 1:24324315-24324337 TTCATCGTCAGGACCCAGGTGGG - Intronic
903885813 1:26540443-26540465 TTCATCCTCAGGACCCAGCTGGG + Intronic
904498658 1:30901754-30901776 TTCTTCAGTAAGACCCAGAGAGG + Intronic
906186429 1:43865521-43865543 TTCATCCTTAGTACCCAGCATGG - Intronic
908422239 1:63970237-63970259 ATCACCATTAAGACACTGCTTGG + Intronic
908581554 1:65522445-65522467 TCAATGAATAAGACCCAGCTTGG + Intronic
909484997 1:76162677-76162699 TACATCCATTAGACCCAGCTGGG - Intronic
910899469 1:92104424-92104446 GTTATCAATAAGACCCAGATAGG + Intronic
912572496 1:110634791-110634813 TTCATCACTTAGCACCAGCTGGG + Intergenic
916696839 1:167246193-167246215 TTTTTCATGAAGACCCACCTAGG + Intronic
916836892 1:168555046-168555068 GTCATGATTAAGACCTAACTTGG + Intergenic
918243767 1:182641765-182641787 TTCTTCATAAAGAGTCAGCTGGG + Intergenic
921627882 1:217398260-217398282 TTCAGCATTAAGACCGAACAGGG - Intergenic
923115242 1:230930622-230930644 TTTAACAGTAAGAACCAGCTGGG + Intronic
923501431 1:234568451-234568473 TTCACCACTATGACCCAGCTTGG + Intergenic
923965296 1:239131280-239131302 TTAATGATTTAGACCCAGTTTGG - Intergenic
924319059 1:242828986-242829008 CTCATCACAAAGACACAGCTGGG - Intergenic
924465088 1:244292206-244292228 TAAATCATTATGACCCTGCTGGG - Intergenic
924833952 1:247629119-247629141 TTCAGCACTAGGACCCACCTAGG + Intergenic
1062913699 10:1231257-1231279 GGCATCGTAAAGACCCAGCTAGG - Intronic
1063901978 10:10743060-10743082 TTCATCATTTAGCCTCAACTGGG - Intergenic
1064314345 10:14240867-14240889 TCCATTATTAAGCCCCTGCTGGG + Intronic
1068067135 10:52145746-52145768 TAGATCTTTATGACCCAGCTGGG - Intronic
1070412086 10:76150991-76151013 CTCTCCATTAAGACCCAGCCGGG + Intronic
1075075860 10:119349715-119349737 TTCACCATTCAGACTTAGCTGGG - Intronic
1075367212 10:121902840-121902862 TTCAGCAGTAAGAGCCACCTTGG - Intronic
1075632653 10:124010581-124010603 ATCATCATTAAATGCCAGCTGGG - Intronic
1075789605 10:125074302-125074324 TGCACCATGAAGACCTAGCTGGG + Intronic
1076417445 10:130301446-130301468 TACATCTTTCAGGCCCAGCTGGG + Intergenic
1077584801 11:3443070-3443092 TGCATAATAAAGACCTAGCTTGG + Intergenic
1078889390 11:15540395-15540417 TTCTTCATTAAAATCCAGGTAGG + Intergenic
1079900745 11:26180997-26181019 TTCATCATTTTAACCCACCTAGG - Intergenic
1080947568 11:36991799-36991821 TTCATCATTATGATCTATCTTGG - Intergenic
1083487168 11:62990543-62990565 CTCATCCTTAAGGCCTAGCTTGG - Intronic
1084241700 11:67825710-67825732 TGCATAATAAAGACCTAGCTTGG + Intergenic
1084766956 11:71317574-71317596 TTAAATATAAAGACCCAGCTAGG - Intergenic
1084830639 11:71766219-71766241 TGCATAATAAAGACCCAGCTTGG - Intergenic
1087008386 11:93490850-93490872 TTCGTCTTTCAGACCCTGCTTGG - Intronic
1087564753 11:99840231-99840253 TTTATCATTAAGAGACAACTTGG - Intronic
1089504777 11:118956112-118956134 TACACCATCAAGACCCAGCCAGG + Intronic
1092411955 12:8260381-8260403 TACATAATAAAGACCTAGCTTGG + Intergenic
1093884537 12:24444432-24444454 TTCATCATTAACAGGAAGCTAGG + Intergenic
1095573708 12:43710531-43710553 TTCCACATTAGGACTCAGCTAGG + Intergenic
1098754006 12:74334696-74334718 TTAATTATTAAAAACCAGCTTGG - Intergenic
1099115025 12:78613210-78613232 TTCATCAATTAGAACCAGCAAGG + Intergenic
1102749832 12:115282810-115282832 TTCACCTTTAAGTTCCAGCTGGG - Intergenic
1109160107 13:58961821-58961843 TTCATGAATAAGCCCCAGCCTGG + Intergenic
1120262118 14:82198948-82198970 CTCACCATGAAGCCCCAGCTGGG + Intergenic
1121941552 14:98075568-98075590 TTTAGCAGTAAGACCCAGATGGG + Intergenic
1121949033 14:98153188-98153210 TTCATCACTAAAGCCCAGCGAGG + Intergenic
1126421561 15:48478570-48478592 TACATAATTAAGGCCCTGCTAGG - Intronic
1131256428 15:90865678-90865700 TTCAACATCTGGACCCAGCTTGG + Intergenic
1133353199 16:5116619-5116641 TGCATAATAAAGACCTAGCTTGG + Intergenic
1133780599 16:8936129-8936151 TTGTCCATGAAGACCCAGCTCGG + Intronic
1137335841 16:47547801-47547823 CTCATCATTAATCCACAGCTTGG + Intronic
1137692334 16:50437698-50437720 TCCAACATTAAGACTCAGCCTGG - Intergenic
1144055932 17:11540483-11540505 TTCATCACTCAGGCCCAGTTTGG + Intronic
1148111392 17:45146465-45146487 TTCATCCTTCAGAGCCAGCCAGG + Intergenic
1148122817 17:45222490-45222512 TTAGACCTTAAGACCCAGCTGGG - Intronic
1151103168 17:71579062-71579084 ATAATCATTAAGGCCCAGCTAGG - Intergenic
1159952653 18:74496427-74496449 TCCATCAGGAAGACCCACCTGGG - Exonic
1160034487 18:75287658-75287680 TCCATCATGAACACCCACCTGGG + Exonic
1164567777 19:29340222-29340244 TTCAGAATTAAGGCTCAGCTGGG + Intergenic
925676765 2:6370799-6370821 GTCATCATTATGACCTTGCTTGG + Intergenic
926737302 2:16083273-16083295 TCCATCCTTAAGGCTCAGCTGGG + Intergenic
928333240 2:30373986-30374008 CTCTTCTTTATGACCCAGCTGGG + Intergenic
928774292 2:34739650-34739672 TTCTTCGTCAAGAACCAGCTGGG - Intergenic
931531986 2:63225610-63225632 TTCATCATTAAGAAACATTTGGG - Intronic
935305950 2:101736412-101736434 TTCATGACCAGGACCCAGCTGGG - Intronic
939875420 2:147572079-147572101 TTAATCATCAAGACACAGCTTGG + Intergenic
940315256 2:152321054-152321076 TTCAGCATTAGGACTCACCTAGG + Intergenic
940552568 2:155179682-155179704 TACATAATTAAAACTCAGCTAGG - Intergenic
945541266 2:211089971-211089993 TTCTTTAATAAGACCGAGCTCGG - Intergenic
1170162834 20:13332649-13332671 TTCATCACTAATCCCCAGTTAGG - Intergenic
1173064172 20:39693724-39693746 TGCATAATTATGACCAAGCTAGG - Intergenic
1181658508 22:24321612-24321634 ATCCTCATTAATGCCCAGCTGGG - Exonic
1182873567 22:33670335-33670357 TTAATCTTTAAGACTGAGCTGGG - Intronic
1184278935 22:43426332-43426354 TCCCTCATCCAGACCCAGCTTGG - Intronic
1184763780 22:46561144-46561166 TTAAAGATTCAGACCCAGCTGGG + Intergenic
949096132 3:87871-87893 TTCATCATTAAATCTAAGCTGGG - Intergenic
950172336 3:10847654-10847676 CTCATCATTAATAACGAGCTGGG - Intronic
950774773 3:15340039-15340061 CTCATCACCATGACCCAGCTTGG + Intronic
952271833 3:31840529-31840551 TTCATCAGCAATACCAAGCTTGG - Intronic
954660225 3:52223090-52223112 TTCATCAACCAGGCCCAGCTCGG - Exonic
954774615 3:53005605-53005627 TTCAAAATTAAATCCCAGCTGGG - Intronic
955396213 3:58559615-58559637 TTAATCATTAAGCCACAGCCTGG - Intergenic
955542797 3:59995760-59995782 TTCAACATAAAGAACCAACTCGG + Intronic
957936165 3:86945588-86945610 ATTATCATTAAGACACTGCTAGG - Exonic
961296289 3:125887109-125887131 TGCATAATAAAGACCTAGCTTGG - Intergenic
964290806 3:155178212-155178234 TTCGTCTTTAAGACTCATCTAGG + Intronic
965885193 3:173436832-173436854 TTTATCACTATGACCCAGGTTGG + Intronic
967654804 3:192034142-192034164 TTCATCATAAAGACCCATCCAGG - Intergenic
968378388 4:65138-65160 ATCTTCAGTAAGACCAAGCTCGG + Intronic
968999991 4:3972890-3972912 TGCATAATAAAGACCTAGCTTGG + Intergenic
969754023 4:9135725-9135747 TGCATAATAAAGACCCAGCTTGG - Intergenic
976009899 4:80474505-80474527 ATCATCTTAAAGTCCCAGCTGGG - Intronic
980949726 4:139362648-139362670 TTGAACATTAAAAACCAGCTTGG + Intronic
982748095 4:159126367-159126389 TTCATCATTCTTACCAAGCTGGG + Intronic
983409491 4:167379015-167379037 GTAATCATTAAGACCCACCATGG + Intergenic
984363859 4:178772918-178772940 CTCATGATTTTGACCCAGCTTGG + Intergenic
987206371 5:15631129-15631151 TTCAACATTAAAACCCTGTTGGG - Intronic
993184720 5:84602485-84602507 TTCATCACTCAGTCCAAGCTAGG + Intergenic
1000242154 5:159418626-159418648 TTCATTATAAATACCCATCTTGG - Intergenic
1001863647 5:175083367-175083389 TTCATCATGAAGCAACAGCTTGG + Intergenic
1004602159 6:17160705-17160727 TGCATCCTTAAGACCTAGCATGG - Intergenic
1005065570 6:21814492-21814514 TCCATCATTAAGTCCGACCTGGG - Intergenic
1005404741 6:25474408-25474430 TTAATAATTAATACTCAGCTGGG - Intronic
1010116476 6:72317176-72317198 TTCAGCATCAAGTCCCTGCTAGG - Intronic
1012072507 6:94640466-94640488 TCCATCATTAAGCCCCATCAAGG - Intergenic
1013069998 6:106720548-106720570 TTCATCATAATGAACCACCTGGG - Intergenic
1014209423 6:118692106-118692128 GTCATCATTAAGACCCAGAAAGG - Intronic
1016365308 6:143309764-143309786 TTAAACATAAAGACACAGCTGGG + Intronic
1018668996 6:166164325-166164347 TGGATCATTGAGACCTAGCTGGG - Intronic
1030157043 7:106465831-106465853 TTCTTCATTTAGACCCAGGATGG - Intergenic
1033197025 7:139336580-139336602 ATCATCATAATGACCCAGATAGG + Intergenic
1034510137 7:151527402-151527424 TTCACCATTATTACCCAGCATGG + Intergenic
1036377239 8:8211062-8211084 TACATAATAAAGACCTAGCTTGG - Intergenic
1036475663 8:9090867-9090889 TTCATCACTCAGAAACAGCTTGG - Intronic
1036852308 8:12212089-12212111 TACATAATAAAGACCTAGCTTGG + Intergenic
1036873676 8:12454610-12454632 TACATAATAAAGACCTAGCTTGG + Intergenic
1042971835 8:74417062-74417084 TTCACCACTCAGACACAGCTGGG + Intronic
1043043775 8:75295261-75295283 TTCAGAATTCAGACCCAGATTGG + Intergenic
1046423300 8:114012505-114012527 TTTAGCATTAAAACCCAGCTTGG - Intergenic
1046763651 8:118046754-118046776 TTCGTCATTTAGTTCCAGCTGGG - Intronic
1047778978 8:128096621-128096643 CTCAGGATGAAGACCCAGCTTGG + Intergenic
1048801304 8:138196658-138196680 TTCAACATTAGAACCCTGCTGGG - Intronic
1049725788 8:144145373-144145395 TTCAACAATAAAACCCAGCTTGG + Intergenic
1049791562 8:144474815-144474837 TTCAGCATCAAGTCCCTGCTAGG - Exonic
1055900745 9:81233054-81233076 TTAATTATGAAGACCCAGATGGG - Intergenic
1056469301 9:86889769-86889791 TTCATAATTAAAACAAAGCTGGG - Intergenic
1058120735 9:101135851-101135873 TTCTTCATTGAGAGCCTGCTGGG - Intronic
1059322576 9:113481128-113481150 ATCATCATTAAGACTCAGGAAGG + Intronic
1061811762 9:133166490-133166512 TTCCTCATTTAAACCCTGCTCGG - Intergenic
1062295975 9:135826860-135826882 TTCATCATGAAGACCTAATTTGG - Intronic
1203570850 Un_KI270744v1:129112-129134 ATCTTCAGTAAGACCAAGCTCGG - Intergenic
1187996157 X:24929156-24929178 TTCATCATTAAGACCCAGCTAGG + Intronic
1192618322 X:72651007-72651029 TTTATAATTTATACCCAGCTGGG - Intronic
1194126603 X:90025846-90025868 TTCATCATGAAGACTTTGCTAGG - Intergenic
1194223552 X:91227009-91227031 TTCAGCACTAGGACTCAGCTAGG - Intergenic
1194253099 X:91602577-91602599 TTCAGCACTAAGACTCACCTAGG - Intergenic
1195984639 X:110615514-110615536 TTCAGCATTAGGACTCACCTAGG + Intergenic
1200560018 Y:4690391-4690413 TTCAGCACTAGGACTCAGCTAGG - Intergenic
1200572035 Y:4843821-4843843 TTCAGCACTAAGACTCACCTAGG - Intergenic
1200709538 Y:6471203-6471225 TTCTTCAGGAAGACCCACCTAGG + Intergenic
1201024574 Y:9693505-9693527 TTCTTCAGGAAGACCCACCTAGG - Intergenic