ID: 1187996161 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:24929177-24929199 |
| Sequence | GGATCCTTGGATCTAATACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187996155_1187996161 | 27 | Left | 1187996155 | X:24929127-24929149 | CCTGCACCAAATTGGGTTGGCTA | No data | ||
| Right | 1187996161 | X:24929177-24929199 | GGATCCTTGGATCTAATACTTGG | No data | ||||
| 1187996156_1187996161 | 21 | Left | 1187996156 | X:24929133-24929155 | CCAAATTGGGTTGGCTATAATTT | No data | ||
| Right | 1187996161 | X:24929177-24929199 | GGATCCTTGGATCTAATACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187996161 | Original CRISPR | GGATCCTTGGATCTAATACT TGG | Intronic | ||