ID: 1187996161 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:24929177-24929199 |
Sequence | GGATCCTTGGATCTAATACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1187996155_1187996161 | 27 | Left | 1187996155 | X:24929127-24929149 | CCTGCACCAAATTGGGTTGGCTA | No data | ||
Right | 1187996161 | X:24929177-24929199 | GGATCCTTGGATCTAATACTTGG | No data | ||||
1187996156_1187996161 | 21 | Left | 1187996156 | X:24929133-24929155 | CCAAATTGGGTTGGCTATAATTT | No data | ||
Right | 1187996161 | X:24929177-24929199 | GGATCCTTGGATCTAATACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1187996161 | Original CRISPR | GGATCCTTGGATCTAATACT TGG | Intronic | ||