ID: 1187996161

View in Genome Browser
Species Human (GRCh38)
Location X:24929177-24929199
Sequence GGATCCTTGGATCTAATACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187996155_1187996161 27 Left 1187996155 X:24929127-24929149 CCTGCACCAAATTGGGTTGGCTA No data
Right 1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG No data
1187996156_1187996161 21 Left 1187996156 X:24929133-24929155 CCAAATTGGGTTGGCTATAATTT No data
Right 1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187996161 Original CRISPR GGATCCTTGGATCTAATACT TGG Intronic