ID: 1187996161

View in Genome Browser
Species Human (GRCh38)
Location X:24929177-24929199
Sequence GGATCCTTGGATCTAATACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187996156_1187996161 21 Left 1187996156 X:24929133-24929155 CCAAATTGGGTTGGCTATAATTT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1187996155_1187996161 27 Left 1187996155 X:24929127-24929149 CCTGCACCAAATTGGGTTGGCTA 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187996161 Original CRISPR GGATCCTTGGATCTAATACT TGG Intronic
903017521 1:20370811-20370833 GGCCCCTGGGCTCTAATACTGGG - Intergenic
904095440 1:27973286-27973308 GAATTCTTGGGTCTAATACCCGG + Exonic
918573163 1:186022983-186023005 GGATTTTTGTATCTTATACTTGG - Intronic
920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG + Intronic
921929358 1:220742484-220742506 GGGTCCTTGGTTCTAAGACCGGG - Intergenic
1067840349 10:49671426-49671448 GGATCCTTTTTTCTAATTCTGGG + Intergenic
1070986199 10:80692294-80692316 GGATCCTTTGATTTCACACTTGG + Intergenic
1071790589 10:88949959-88949981 TTATACTTGGATCTTATACTTGG + Intronic
1076466462 10:130685826-130685848 AAATCCTTGGGTCTAATCCTTGG + Intergenic
1079118019 11:17652964-17652986 GGATCCTTGGAGCTGATCTTCGG + Intergenic
1083082958 11:60112695-60112717 GGATCATTGGTTCTCATACTTGG - Intergenic
1090827015 11:130394721-130394743 TGATGCTTGGATGTACTACTCGG + Intergenic
1091950762 12:4591223-4591245 GGATCCTGGGTTTTAATGCTAGG - Exonic
1098939757 12:76520373-76520395 GGAGCCTTGGATCTAATGGGGGG - Intronic
1099420383 12:82451056-82451078 GGTTCTTTGGTTCTATTACTTGG - Intronic
1110986167 13:81972131-81972153 GGATCATTTGATAAAATACTAGG + Intergenic
1112345376 13:98584890-98584912 AGATCCTTGGATCTAGCACCAGG - Intergenic
1119596057 14:75935046-75935068 GGATCCTTTGAACTAAAGCTTGG - Intronic
1126763780 15:51993280-51993302 GGATCTTTTGTTCTAATATTTGG - Intronic
1144248079 17:13387360-13387382 GCATCTTTTGTTCTAATACTTGG - Intergenic
1147445005 17:40469707-40469729 GGATCCTTGGGTCTCATTATGGG + Intergenic
1148844462 17:50521088-50521110 GGGTCCTTGGACCTCATGCTAGG + Exonic
1153517513 18:5917807-5917829 GGATCTTTGCATCTGTTACTTGG + Intergenic
1156742401 18:40347925-40347947 GGCTCCTAGGAGCAAATACTTGG + Intergenic
1158726141 18:59974477-59974499 GGAGCATTGCATCTAATTCTGGG - Intergenic
1160019084 18:75166594-75166616 GGATCCTTGTATGGAAGACTGGG - Intergenic
1164553676 19:29233414-29233436 GGATCTTACGATCTAATAATGGG - Intergenic
1165774209 19:38395422-38395444 GGATCCTTGAGGCTAAGACTGGG + Intronic
1166228405 19:41411398-41411420 GGATCCTTGTCCCTGATACTAGG - Intronic
926160280 2:10482930-10482952 GAATCTTTGGTTCTAATATTCGG - Intergenic
929961782 2:46502641-46502663 GGATCCTTGCTTCTCTTACTGGG - Intronic
931052688 2:58431471-58431493 GGGTTTTTGGATCTATTACTTGG + Intergenic
945491952 2:210466455-210466477 GGTTCCTTTGTTCTTATACTAGG - Intronic
946940222 2:224762352-224762374 GAATATGTGGATCTAATACTTGG - Intergenic
1169429798 20:5526221-5526243 GTATCCTTGATTCTAACACTAGG - Intergenic
1169954225 20:11083279-11083301 GGAACCTTGGATTTAATTATTGG + Intergenic
1171908563 20:30921237-30921259 GGATCCCTGGATCCAAGCCTTGG - Intergenic
1183064205 22:35352494-35352516 TAATCCTTGGATCTAAGGCTAGG - Intergenic
1183375457 22:37462216-37462238 GCACCCTGGGATCTGATACTGGG - Intergenic
951149043 3:19265562-19265584 GGAGCCTGGAATCTAATGCTTGG + Intronic
952639799 3:35579785-35579807 GGATCCTTAGTTCTAGAACTTGG + Intergenic
953573053 3:44087782-44087804 GGATCTTTTGTTCTAATATTTGG - Intergenic
957716807 3:83938562-83938584 GGAATCATGGATCTAGTACTTGG - Intergenic
965901720 3:173648874-173648896 GGATGGTTGGATCTTATAGTAGG - Intronic
967722600 3:192831148-192831170 GGTTCCTTGGATCACATGCTTGG + Intronic
968870219 4:3238360-3238382 AGGGCCTTGGCTCTAATACTGGG - Intronic
973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG + Intronic
986236699 5:5917240-5917262 TCATCCTTGTATGTAATACTTGG + Intergenic
989430071 5:41343129-41343151 GGATCCTTAGAGCTAAACCTAGG + Intronic
990633995 5:57702726-57702748 GGTTCCTTTAATTTAATACTTGG + Intergenic
993852161 5:93023784-93023806 GGATCCTGGGATCTTCCACTGGG + Intergenic
994310409 5:98262546-98262568 ACATCCTTGGCTCTAAAACTGGG + Intergenic
1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG + Intronic
1001185976 5:169573104-169573126 AGTTCCTTGGATCTTATACTGGG - Intergenic
1001629698 5:173165524-173165546 TGATCCTTGGCTCAAACACTTGG + Intergenic
1001945125 5:175772317-175772339 GGATCTTTGGTTCTGATATTTGG - Intergenic
1011058479 6:83234090-83234112 GAGTCCATGGATATAATACTTGG - Intronic
1011118585 6:83924694-83924716 GGGTCCTTGTATCTACTGCTAGG + Intronic
1024443025 7:49443566-49443588 GGATTCTTAGATCTGGTACTTGG + Intergenic
1024887621 7:54162237-54162259 GTTTCCTTGGATTTAAAACTAGG + Intergenic
1032571757 7:133007863-133007885 GGATGCTCGGATCTAATTCATGG - Intronic
1033568295 7:142601440-142601462 GGATCCTTGGTTCAAATATTTGG - Intergenic
1034711298 7:153193561-153193583 GGATGCTTGTCTGTAATACTTGG - Intergenic
1042177522 8:66051769-66051791 GGAACATTGGATCTAAAATTTGG - Intronic
1042280892 8:67054826-67054848 GTATCCTTGGATTTAAAACAGGG - Intronic
1043858160 8:85285649-85285671 GGATCCTTGGTTCTAGGGCTAGG - Intergenic
1044537319 8:93372105-93372127 GGATCTTTGGCTCTGAGACTGGG - Intergenic
1044947442 8:97402888-97402910 GGATCACTGGATCAAATAGTAGG + Intergenic
1047994592 8:130321830-130321852 AGAGCCTTGAATCTCATACTAGG - Intronic
1053164013 9:35832035-35832057 TGATCCTTGGATCTTTTCCTTGG + Intronic
1058682548 9:107452728-107452750 GGATCTATGGATCTGAGACTGGG - Intergenic
1060022949 9:120147927-120147949 GGATCATTGGAGCTAATTCAGGG - Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1195747033 X:108129311-108129333 GTTTCCTTGGAACTAATTCTAGG + Intronic
1196678745 X:118448615-118448637 GGATGCTTGGACCTATTCCTAGG - Intronic
1199117103 X:144006290-144006312 GGGTTCTTGGATCTCATACAAGG + Intergenic