ID: 1187999994

View in Genome Browser
Species Human (GRCh38)
Location X:24971880-24971902
Sequence AGGATTTTAAAGATGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 453}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187999988_1187999994 -9 Left 1187999988 X:24971866-24971888 CCAAGATATTATTCAGGATTTTA 0: 1
1: 0
2: 1
3: 36
4: 844
Right 1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG 0: 1
1: 0
2: 2
3: 46
4: 453
1187999984_1187999994 29 Left 1187999984 X:24971828-24971850 CCTGGGCTAAGTATTACCTCACT 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG 0: 1
1: 0
2: 2
3: 46
4: 453
1187999983_1187999994 30 Left 1187999983 X:24971827-24971849 CCCTGGGCTAAGTATTACCTCAC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG 0: 1
1: 0
2: 2
3: 46
4: 453
1187999986_1187999994 13 Left 1187999986 X:24971844-24971866 CCTCACTACTCTAATATGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG 0: 1
1: 0
2: 2
3: 46
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187999994 Original CRISPR AGGATTTTAAAGATGGAGGG GGG Intronic
901137298 1:7006217-7006239 AGGATTTTAAGGATAGAGTTGGG - Intronic
902066145 1:13689645-13689667 AGAATTCTAGAGATGGATGGTGG + Intergenic
902190426 1:14759056-14759078 GGGATTTTAAGAAGGGAGGGAGG + Intronic
904401334 1:30258507-30258529 AGGATGGTAAAGATGGAAGAGGG + Intergenic
904714772 1:32459268-32459290 AGGGATTTAAAAAGGGAGGGGGG - Intergenic
904941811 1:34168928-34168950 ATGACTTTTCAGATGGAGGGAGG + Intronic
906168435 1:43705143-43705165 GGGATTTTAATGATGGAAGCAGG + Exonic
906333759 1:44910207-44910229 GGAATTTTAGAGCTGGAGGGGGG + Intronic
906340305 1:44973862-44973884 AAGGTTATAGAGATGGAGGGTGG + Intronic
906802965 1:48753497-48753519 AGGATTTTAAAGATCAAAGCTGG + Intronic
906940263 1:50249458-50249480 AGGAGTTGGAAGATGGAGGATGG - Intergenic
907676061 1:56518991-56519013 AGGCTTCTAAAGAAGGTGGGTGG + Intronic
908082436 1:60595689-60595711 CTGACTTTAAAGATGGAGAGAGG - Intergenic
908131568 1:61080755-61080777 AGGATGTTCAGGAGGGAGGGTGG + Intronic
908287315 1:62621156-62621178 AGGATTTAGACGAGGGAGGGAGG + Intronic
909043178 1:70677990-70678012 AGGATTTTTAAGCTGGACGGTGG + Intergenic
909278651 1:73721182-73721204 AGGACTTAAAAGATGCAGGGTGG + Intergenic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
911817467 1:102371413-102371435 TGGATTATAAAGATGGCAGGAGG - Intergenic
913050186 1:115110582-115110604 AGGACTTTAAAAATGAAGGAGGG - Intergenic
914225676 1:145717947-145717969 AGGAATTCAAGGGTGGAGGGAGG - Intergenic
914265967 1:146038692-146038714 AGAATTTTTAAGATGGTGGCGGG + Intergenic
914742279 1:150474867-150474889 AGAATATTAAAGATGGGGGAGGG + Intronic
914812131 1:151036690-151036712 AGGTGTTTAAAGAAGGAGGCAGG + Exonic
915040529 1:152964715-152964737 AGCAAGTGAAAGATGGAGGGAGG - Intergenic
915167605 1:153957334-153957356 AGGAATTTAAGGATTGATGGTGG - Intronic
916817690 1:168369705-168369727 ATTTTTTTAAAGAAGGAGGGTGG - Intergenic
916834885 1:168533292-168533314 AGGATTTTAGAGCTCGAGGATGG + Intergenic
917268048 1:173242717-173242739 TGGTTTTTGAAGATGGAGGGAGG + Intergenic
917461141 1:175230440-175230462 AGTATTTTAACAATGGAAGGAGG - Intergenic
917739722 1:177950922-177950944 AGGATGTAAAGGAGGGAGGGAGG + Intronic
917739755 1:177951010-177951032 AGGATGTAAAGGAGGGAGGGAGG + Intronic
919448251 1:197737347-197737369 ATTATTTTAAGGATGGAGGTGGG - Intronic
921512365 1:216047656-216047678 AGGGTTTAAAAGAGGAAGGGGGG + Intronic
923212478 1:231816928-231816950 AGGAGGTGAAAGAGGGAGGGAGG - Intronic
923810824 1:237313469-237313491 TGCACTTTAAAGATGGAGGAAGG + Intronic
923832121 1:237569914-237569936 AGAGTTGTAAAGATGGAGGGTGG + Intronic
924055887 1:240123753-240123775 AGAGTTCTAAAGATGGATGGTGG - Intronic
924091681 1:240507771-240507793 AGAATTTCAGAGAAGGAGGGTGG + Intronic
924928542 1:248706685-248706707 AGGGGCTTAAAGATGAAGGGAGG - Intergenic
1062979369 10:1708992-1709014 AACATTTTAAATATGGAGGGAGG + Intronic
1063428418 10:5967090-5967112 TGGATTTTTGAGATGGAGGTGGG - Intronic
1063644992 10:7870825-7870847 AGCATCTTAAATATGGAGTGGGG - Intronic
1063732351 10:8712352-8712374 ATGATTTAAGAGATAGAGGGAGG - Intergenic
1063845950 10:10126920-10126942 GGGATTTTAAACATAGAAGGAGG - Intergenic
1063915862 10:10881523-10881545 AGGATGCTAAATCTGGAGGGTGG - Intergenic
1064331046 10:14394537-14394559 AGAATTTTAAAAATGGAGGAAGG + Intronic
1064587383 10:16852224-16852246 AGGGATGGAAAGATGGAGGGAGG - Intronic
1064587395 10:16852264-16852286 AGGAAGGGAAAGATGGAGGGAGG - Intronic
1064587403 10:16852300-16852322 AGGGATGGAAAGATGGAGGGAGG - Intronic
1066454640 10:35562401-35562423 AGGGTTCTAGAGATGGATGGTGG - Intronic
1068746439 10:60536431-60536453 AGGATTTTAAAGAAGGAAAGCGG - Intronic
1069775497 10:70924893-70924915 AGGACTTTAATGGTGGAGAGAGG + Intergenic
1070315348 10:75305603-75305625 AGAATTTTGAAGATGGATGGAGG - Intergenic
1072761504 10:98060670-98060692 GGGTTTTAAAAGATGGAGAGAGG + Intergenic
1072777638 10:98215932-98215954 AGGAGTTTAAAGATTGAAGCTGG + Intronic
1074930771 10:118123563-118123585 GGGAGTTTTGAGATGGAGGGAGG + Intergenic
1075072437 10:119327846-119327868 GGGATTTTAGGGATGGAAGGTGG - Intronic
1076120470 10:127932972-127932994 CGGGCTTTAAAGATGGAGGAAGG - Intronic
1076271220 10:129153705-129153727 AAGATTTAAAGGATGGTGGGGGG - Intergenic
1076487935 10:130836197-130836219 AGGATCTTGCAGATGGACGGTGG - Intergenic
1076825254 10:132963948-132963970 AGGCTTGCAAAGATGGAGGTGGG - Intergenic
1077389932 11:2296125-2296147 AGGACTTGGAAGATGCAGGGTGG - Intronic
1077675209 11:4188853-4188875 AGCATTTTAAAGAGCCAGGGAGG - Intergenic
1078614173 11:12849366-12849388 CGGAGTTTAGAGATGGTGGGAGG - Intronic
1079266095 11:18934492-18934514 AGGATTTTAGAGATGGTATGGGG + Exonic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1080279607 11:30541546-30541568 AGGATTTTAAAGTGGAATGGGGG - Intronic
1080631217 11:34078560-34078582 AAGATTTTAAAGAGGGAGAGGGG - Intronic
1081085964 11:38801815-38801837 AGTATTCTAAAGGTGGAGGATGG + Intergenic
1081396467 11:42591909-42591931 AGGATTATAATGAAGGGGGGAGG - Intergenic
1081755552 11:45541833-45541855 AGAATTTTCAAGCTAGAGGGTGG - Intergenic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1083030622 11:59588595-59588617 AGAGTTTTGGAGATGGAGGGTGG + Intronic
1084896698 11:72276606-72276628 AGAATTATGAAGATGGACGGTGG - Intergenic
1086182295 11:83967557-83967579 AGGATTTTAAAAATGCACAGAGG - Intronic
1086501833 11:87461682-87461704 AGGATTTTAAAGAATGAAAGCGG - Intergenic
1087086039 11:94219697-94219719 GGGATTTTAAAAGGGGAGGGGGG + Intergenic
1088407730 11:109499621-109499643 AGGGCTTGAAAGATGCAGGGGGG - Intergenic
1088535449 11:110855320-110855342 AGGCTTCCAGAGATGGAGGGAGG - Intergenic
1088549410 11:110996121-110996143 AGACTTTTAAAGATTGAGTGGGG + Intergenic
1088934380 11:114384255-114384277 AGGATATTTAAGTTGGAGAGTGG + Intergenic
1089435030 11:118457728-118457750 AGGATGATAAAGCTGGTGGGGGG - Intronic
1089814280 11:121158610-121158632 AGGATGGCAAAGATGAAGGGTGG - Intronic
1090209617 11:124909000-124909022 AGGACTTGAAATATGCAGGGTGG - Intergenic
1091602049 12:1923718-1923740 AGGGTTCTGGAGATGGAGGGTGG + Intergenic
1092555406 12:9555065-9555087 AGGTTATTCAAGCTGGAGGGAGG + Intergenic
1092829802 12:12432863-12432885 AGTGTTTTAAAGATGGAAAGGGG + Intronic
1093719186 12:22418678-22418700 CTGGTTTTGAAGATGGAGGGAGG + Intronic
1094516692 12:31135617-31135639 AGGTTATTCAAGCTGGAGGGAGG - Intergenic
1094666173 12:32523380-32523402 AAAATTCTAAAGATGGATGGTGG - Intronic
1095365687 12:41401802-41401824 AGGAGATTAAAGATGGAGACTGG - Intronic
1095941585 12:47730836-47730858 AGGATTGTACAGCTGGTGGGTGG - Intergenic
1096585504 12:52617174-52617196 AGGAGTTTTCAGATGGAGGTGGG - Intronic
1096988159 12:55775738-55775760 AGTATTTTGGAGATGGAGGTGGG - Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098551247 12:71763684-71763706 AGGATTTGAAGGAGGTAGGGTGG + Intronic
1098826464 12:75303891-75303913 AAGACTTTGAAGATGGAGGAAGG + Intronic
1099138714 12:78942431-78942453 AGAATTGGAAAGATGGAGAGAGG - Intronic
1099587351 12:84535323-84535345 TGGATTTTGAAGAAGGAGTGGGG + Intergenic
1100276120 12:93073438-93073460 AGGGTTTTAGAGATGGATGGTGG - Intergenic
1100276130 12:93073482-93073504 AGGGTTTTAGAGACGGATGGTGG - Intergenic
1100276140 12:93073526-93073548 AGGGTTTTAGAGACGGATGGTGG - Intergenic
1100370858 12:93967202-93967224 AGGAATGGAGAGATGGAGGGAGG - Intergenic
1100514922 12:95318117-95318139 AGGAATTTAAACATTGAGGATGG - Intergenic
1101984310 12:109433701-109433723 AGGAGTCTACAGATGGAGAGAGG - Intronic
1102150319 12:110685253-110685275 AGTGCTTTAAAGATGGAGGATGG + Intronic
1102345803 12:112160657-112160679 AAGAATTTAAAGATGTAGGGAGG + Exonic
1102593313 12:113973744-113973766 AGAACTTTGAGGATGGAGGGAGG - Intergenic
1102620941 12:114193934-114193956 AGCACTTTGAAGATGGAGGAAGG + Intergenic
1102816293 12:115869025-115869047 AGAATTGTAAAAATGGAGGGAGG + Intergenic
1104126270 12:125849106-125849128 AAGATTTTAAATGTGGAAGGAGG - Intergenic
1104289065 12:127451907-127451929 ATGGCTTTAAAGATGGAAGGGGG - Intergenic
1105420762 13:20249631-20249653 TGGATGTCAAAGATGGAGGCCGG - Intergenic
1106610218 13:31272089-31272111 AAGATTTTCAAACTGGAGGGTGG - Intronic
1107014660 13:35698331-35698353 AGCATTTAAGCGATGGAGGGAGG + Intergenic
1107422424 13:40260900-40260922 AGGATATTAGAGATGGTGGAAGG - Intergenic
1107588663 13:41880908-41880930 AGGATGTTAAAGCTGGCAGGTGG - Intronic
1108693598 13:52882620-52882642 AGGATAATAAAGGTGGTGGGGGG + Intergenic
1109492236 13:63116968-63116990 AGGACTTTAAACATAGAGGCTGG - Intergenic
1110162886 13:72400606-72400628 AAGATTTGAAAGATGGAAAGTGG + Intergenic
1110684426 13:78355058-78355080 GGCATTTTTCAGATGGAGGGGGG + Intergenic
1111528244 13:89501744-89501766 ATGATTTTAAAGCTGTAGGCAGG - Intergenic
1112693848 13:101926003-101926025 AGGATCTTGAAGAGGGAGGCAGG - Intronic
1113133568 13:107063889-107063911 AGGAATTTAAAGATGGTTGGGGG + Intergenic
1113163622 13:107411906-107411928 AGGAGTTTGAAGATGGGAGGTGG + Intronic
1113332360 13:109342109-109342131 CTGGTTTTAAAGGTGGAGGGAGG + Intergenic
1114212509 14:20627083-20627105 AGGATTTTGAATGAGGAGGGAGG - Intergenic
1114996248 14:28355714-28355736 TGGATTTTAAGGGTGAAGGGTGG - Intergenic
1115914499 14:38296381-38296403 AGGAGTTAAAAAATGTAGGGAGG + Intergenic
1116159439 14:41250319-41250341 AGAATTTGTAAGATGGAGAGTGG - Intergenic
1116631495 14:47340997-47341019 AGGAAATTAAATATAGAGGGTGG - Intronic
1116840510 14:49816473-49816495 AGGATTTCAAAAGGGGAGGGAGG - Intronic
1116996135 14:51327259-51327281 AGGATTGTCAAGAAGGAGGGAGG + Intergenic
1117321644 14:54629765-54629787 AGAGTTCTAAAGATGGATGGTGG - Intronic
1117748479 14:58896415-58896437 AGGACAATAAAAATGGAGGGGGG - Intergenic
1118733978 14:68689442-68689464 AGGAGAGAAAAGATGGAGGGCGG - Intronic
1119501522 14:75132089-75132111 AAAAGTTTAAAGATGGAGGCTGG + Exonic
1119637043 14:76281982-76282004 AGCATTATGAAGATGGATGGTGG + Intergenic
1119821509 14:77620278-77620300 TGGATGTTAAAGAAGGAGGCTGG + Intergenic
1120073230 14:80126337-80126359 AGAATTTAAAAAATGGAGAGAGG - Intergenic
1120141780 14:80937865-80937887 AGAATTTTAGAGCTGGATGGGGG - Intronic
1121367692 14:93329855-93329877 AGAATTCTACAGATGGATGGTGG + Intronic
1121888995 14:97571960-97571982 AGGGTTTTGATGATGGAAGGAGG - Intergenic
1122320459 14:100852276-100852298 AGGATATGAAGGAGGGAGGGAGG + Intergenic
1124215369 15:27803640-27803662 AGAGTTTTGAAGATGGATGGTGG + Intronic
1126457244 15:48877120-48877142 AGGATGTTGAAAATGGAAGGAGG - Intronic
1127634652 15:60857827-60857849 AGGATATTAGAGCTGGAAGGAGG + Intronic
1127782494 15:62329476-62329498 AGAATTTGAAAGATACAGGGCGG - Intergenic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128466334 15:67915660-67915682 TGCCTTTTAAAGAAGGAGGGGGG + Intergenic
1128613157 15:69089777-69089799 AGGGGTTTGAAGATGAAGGGAGG + Intergenic
1129118944 15:73383261-73383283 AGGGCTTTGAAGATGGAGGAAGG + Intergenic
1130038301 15:80381323-80381345 AGGATTGGAAAGATGGTGGGAGG + Intronic
1130717961 15:86354950-86354972 TGGACTTTGAAGATGGAGGCAGG + Intronic
1131657595 15:94477688-94477710 AGGATTTCAAAGATCTGGGGCGG + Intronic
1131807888 15:96141980-96142002 AGGATTTTTACTATGAAGGGAGG + Intergenic
1132079624 15:98852991-98853013 AGCAATTTAAAGAGGAAGGGCGG - Intronic
1132256884 15:100383894-100383916 AGGTTTTTAAAGAGAGAGAGGGG - Intergenic
1132316236 15:100892430-100892452 AGGTTGTTAAAGATGGAAGTTGG - Intronic
1132841995 16:1982590-1982612 AGGAGCATACAGATGGAGGGTGG - Exonic
1132941077 16:2508617-2508639 AGGACTTGAAAGATGAAGAGAGG - Intronic
1133244166 16:4436302-4436324 AAGATTGAAAAGATGGAGGCTGG + Intronic
1133474288 16:6105186-6105208 AGTAACTTAAAAATGGAGGGTGG - Intronic
1133589564 16:7229608-7229630 AGGAGAAGAAAGATGGAGGGAGG + Intronic
1134399588 16:13897084-13897106 AGGATTTTGAAGAGGGAGGGAGG + Intergenic
1134894110 16:17869338-17869360 TGCACTTTAAAGATGGAGGAAGG - Intergenic
1136910229 16:34139496-34139518 AAGCTTTTAAAGATTCAGGGAGG - Intergenic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1140213126 16:72986304-72986326 GGGGTTTTATCGATGGAGGGGGG + Intronic
1140342666 16:74180458-74180480 AGAAATTTAAAGATAGAGGAAGG + Intergenic
1140796018 16:78439039-78439061 AGGTATTTAAAGATGGAAAGGGG - Intronic
1141089890 16:81122940-81122962 AGCATTTTAAAGGGGGAAGGAGG + Intergenic
1142833477 17:2566671-2566693 ATGGTTTTGAAGATGGAAGGGGG + Intergenic
1143058009 17:4176877-4176899 AGGATTTCAATGGTGGAGGCAGG - Intronic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1144577404 17:16437674-16437696 AGGGTTTTAATGGAGGAGGGGGG - Intergenic
1145756762 17:27397713-27397735 AGTATTGAAAAGATGGAGGCTGG + Intergenic
1146324517 17:31874297-31874319 AGCACTTTAAAGACGGAGGCAGG + Intronic
1146636710 17:34511909-34511931 AGGATATTAAAGCTGGGAGGCGG + Intergenic
1146680243 17:34802056-34802078 AAGATGTAAAAGATGCAGGGTGG - Intergenic
1147126379 17:38371875-38371897 GGGATTTTAAAGTTTGAGGTGGG + Intronic
1147778970 17:42925967-42925989 AGGATTTGATGGATGGAGGATGG - Intergenic
1148021324 17:44556095-44556117 AGGATTTTAAATTTGGAAAGGGG - Intergenic
1148316717 17:46707468-46707490 AGAGTTTTAGAGATGGATGGTGG - Intronic
1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG + Intronic
1151304014 17:73251323-73251345 AGGCTTTGAAAGAAGGTGGGAGG - Intronic
1151305431 17:73260111-73260133 AGCATTTCAAAGATGGTGGCAGG + Intronic
1151365643 17:73614561-73614583 AGGATTGAAAAGGGGGAGGGAGG + Intronic
1151365653 17:73614594-73614616 AGGATTGAAAAGGCGGAGGGAGG + Intronic
1151365663 17:73614627-73614649 AGGATTGAAAAGGGGGAGGGAGG + Intronic
1151365695 17:73614718-73614740 AGGATTGAAAAGGGGGAGGGAGG + Intronic
1151365708 17:73614751-73614773 AGGATTGAAAAGGGGGAGGGAGG + Intronic
1151365729 17:73614817-73614839 AGGATTGAAAAGGCGGAGGGAGG + Intronic
1152464957 17:80461172-80461194 AGCATTTAAAAGAAAGAGGGAGG + Intergenic
1155109509 18:22699925-22699947 TGTACTTTAAAGATGGAGGGAGG - Intergenic
1156846944 18:41677046-41677068 TGGATTTGGAAGATGCAGGGGGG - Intergenic
1156888271 18:42160553-42160575 AGGATTTTATAGATCCAGTGAGG + Intergenic
1157531129 18:48421746-48421768 AGGAATTTCAAAGTGGAGGGCGG - Intergenic
1157846094 18:51005267-51005289 AGGACTTGAAACACGGAGGGTGG + Intronic
1157847428 18:51017137-51017159 AGATTTGTAAAGATGGAGGCAGG + Intronic
1158219924 18:55140030-55140052 AGGATTTTAAAAATGATGGGAGG + Intergenic
1159006144 18:63014488-63014510 AGAGTTCTAGAGATGGAGGGTGG - Intergenic
1159449219 18:68578272-68578294 AGGGTTTCAAAGATGGATGGAGG - Intergenic
1160312443 18:77808483-77808505 AGGATTCCAAGGGTGGAGGGAGG - Intergenic
1161881050 19:6952935-6952957 TGCATTTTAAAGATGGCGGGCGG - Intergenic
1162011262 19:7816756-7816778 AGGAGTTTCAAGGAGGAGGGAGG - Intergenic
1162862403 19:13516557-13516579 GGGATATGAAACATGGAGGGAGG - Intronic
1164005622 19:21145838-21145860 AGGATTAGAAAGAAGGTGGGAGG + Intronic
1164558934 19:29275309-29275331 AGGATTTTGCAAATGGAGGTAGG - Intergenic
1165542639 19:36504871-36504893 AGAATTATAAAGATGGGTGGTGG - Intergenic
1167081826 19:47281432-47281454 AACATTTTAAAGATGAATGGTGG - Intergenic
1167918829 19:52764497-52764519 AGGATATCAAAGCTGGATGGTGG - Exonic
1168534599 19:57158481-57158503 AGGCATGGAAAGATGGAGGGGGG + Intronic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
925972150 2:9113364-9113386 AGGATGGGAAAGATGCAGGGAGG - Intergenic
926056964 2:9779326-9779348 ACGGCTTTGAAGATGGAGGGAGG + Intergenic
926572456 2:14544474-14544496 TGAACTTTGAAGATGGAGGGAGG + Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927073547 2:19553989-19554011 AGCATTTGACAGATGGAGGCGGG - Intergenic
927116401 2:19906871-19906893 AGAATTCTGAAGATGGATGGTGG + Intergenic
928172403 2:29012091-29012113 AGGCCTTTAAAGAGGGAGGAGGG + Intronic
928294608 2:30072002-30072024 AGAATTTTAAGAATGTAGGGAGG + Intergenic
928723406 2:34145745-34145767 GGCATTTTAAAGATGGAAAGAGG + Intergenic
929258592 2:39839814-39839836 AGGATTTTAAAGGTTCATGGTGG + Intergenic
929408413 2:41669196-41669218 AGGATGATAAATATGGAGGTAGG - Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
929868659 2:45739529-45739551 AGGTTTTTAAAAAGGAAGGGAGG - Intronic
930228318 2:48817214-48817236 AGGGGTCTCAAGATGGAGGGAGG + Intergenic
930353821 2:50292037-50292059 AGGAATTTCAAGTTGAAGGGTGG - Intronic
930366500 2:50446354-50446376 AGGAGTGAAAAGAGGGAGGGAGG - Intronic
930720648 2:54634453-54634475 AGCATAATAAAGATGGAAGGAGG + Intronic
931103974 2:59033772-59033794 AGGACTTTAAAAATGCATGGTGG - Intergenic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
932266844 2:70374997-70375019 AGGAGTCTAAAGATGGGGAGAGG - Intergenic
932748586 2:74356187-74356209 CGGATGATAGAGATGGAGGGAGG + Intronic
935215182 2:100970280-100970302 AGGATTTGAGAGGTGGAGGATGG - Intronic
935628890 2:105195660-105195682 AGGATTTTAGAGAAGGAGGCTGG + Intergenic
936261178 2:110960552-110960574 AGGATCACAAGGATGGAGGGAGG - Intronic
936523065 2:113224242-113224264 ATGAATTAAAAGATGGATGGAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936889884 2:117356887-117356909 AGCATTATAGAGATGGATGGTGG - Intergenic
937163413 2:119788537-119788559 AGCATTCTGAAGATGGATGGTGG - Intronic
938640885 2:133278392-133278414 TGGCTTTTGAAGATGGAGGAAGG - Intronic
939385934 2:141498335-141498357 AGGATTTTAAAGATGTTGTCTGG - Intronic
940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG + Intronic
941355625 2:164487728-164487750 AGGATTGGAAGGATGAAGGGTGG + Intergenic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
943296847 2:186151129-186151151 ACAATTTTAAAGATGGGGGTTGG - Intergenic
944644135 2:201761521-201761543 AGGATTTTACAGTTGGCGTGTGG - Exonic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946094798 2:217264558-217264580 GGGGTTATAAAGATGGATGGTGG - Intergenic
946530045 2:220560844-220560866 AGGATTTCAAAGGTGTAGGAAGG - Intergenic
947010278 2:225558456-225558478 TGGGCTTTAAAGATGGAGGACGG - Intronic
947912862 2:233812927-233812949 AGGAGTTTAAAGCAGGATGGTGG + Intronic
1168794908 20:604951-604973 AGGAATTTGATGATGGAGAGAGG + Intronic
1169055369 20:2616557-2616579 AGGAAAATAAAGAAGGAGGGAGG + Intronic
1169066528 20:2697152-2697174 AAGATTTTACAGAAGGTGGGTGG + Intronic
1169662286 20:7993203-7993225 AAGATTATAAAGATGGAAGAAGG - Intronic
1169734312 20:8821566-8821588 ACACTTTTAAAAATGGAGGGAGG + Intronic
1170458065 20:16551918-16551940 ATCATTTCAAAGAAGGAGGGTGG + Intronic
1170735831 20:19013450-19013472 AGATATTTTAAGATGGAGGGTGG + Intergenic
1171298592 20:24040041-24040063 GGGATTTTAAGGAGGGAGAGTGG - Intergenic
1171376821 20:24699591-24699613 ATGATGTCAAAGAGGGAGGGCGG - Intergenic
1171905706 20:30898231-30898253 AAGCTTTTAAAGATTCAGGGAGG - Intergenic
1172234955 20:33365566-33365588 AGAATTTTAAACATAGAGGCTGG - Intronic
1172769661 20:37373733-37373755 ATGATTTTTAAGATGGAGCTAGG - Intronic
1173426027 20:42944216-42944238 AGGATTTTAGAGCCGGGGGGCGG + Intronic
1173562055 20:44013083-44013105 AGGATTTAAAACTTGGAGTGGGG + Intronic
1173679206 20:44864769-44864791 AGGGTTGTAAAGCTGGAGTGAGG - Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174510721 20:51050285-51050307 AGGATTTTAGACATAGATGGTGG + Intergenic
1175698246 20:61118598-61118620 AGGATGTTGGAGCTGGAGGGAGG - Intergenic
1176879978 21:14180340-14180362 AGGGTTTTAAAAAGGGAAGGGGG - Intronic
1176926121 21:14751293-14751315 AGGAGTTTAAAGAGGTAGGCAGG - Intergenic
1177116246 21:17090496-17090518 AAGATTTACAAGTTGGAGGGGGG + Intergenic
1177177122 21:17712275-17712297 AGGAAGATAAAGGTGGAGGGTGG - Intergenic
1177448962 21:21239819-21239841 AGCATTTTAAAAATTGAGGTTGG + Intronic
1177785485 21:25666775-25666797 AGCATTTGAGAGATGGAGGTGGG - Intronic
1178417409 21:32415036-32415058 AGGAATTTGCAGAGGGAGGGCGG - Intronic
1179290141 21:40011345-40011367 AGGATGGGAAAGAAGGAGGGAGG + Exonic
1179824051 21:43954165-43954187 AGGACTTTGAAGCTGGAGGCGGG + Intronic
1180339114 22:11604330-11604352 AAGCTTTTAAAGATTCAGGGAGG - Intergenic
1180389129 22:12208865-12208887 AGAATTTGGAAGATGGATGGTGG + Intergenic
1180416813 22:12725606-12725628 AGAATTTGGAAGATGGATGGTGG - Intergenic
1182771494 22:32799990-32800012 AGGTTTTTAAAGCTGGGTGGAGG + Intronic
1182892141 22:33827854-33827876 CGGATTATAGAGATCGAGGGTGG + Intronic
1183209834 22:36444074-36444096 AAGGTTTCAAAGATGGAGGATGG + Intergenic
1183767562 22:39893278-39893300 AGAATTTTGAAAATGGCGGGTGG + Intronic
950385391 3:12655005-12655027 ACTATTTTAGAGATGGCGGGGGG - Intronic
950769343 3:15298858-15298880 AGGGTTCTAGAGATGGATGGTGG + Intronic
951019548 3:17767392-17767414 AGGCATTTAAAGATTGAGGTGGG - Intronic
951052036 3:18104607-18104629 AAGATTTGAAAGATGTTGGGAGG - Intronic
951249648 3:20380132-20380154 AGGTTTCTAGAGATGGAAGGCGG - Intergenic
951650031 3:24941159-24941181 AGGAATAGAAGGATGGAGGGTGG + Intergenic
951665562 3:25119544-25119566 TGCATTTGAAAGATGGATGGGGG - Intergenic
952715600 3:36476817-36476839 AGGGTCTTAAAGCTGGAGAGAGG - Intronic
952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG + Intronic
954601693 3:51875374-51875396 AGGACTTCAAACATGGAGGGGGG + Intronic
956043508 3:65171151-65171173 AGGAATTTTTAGGTGGAGGGAGG + Intergenic
956504639 3:69924627-69924649 AGGATTTGCAAGTTAGAGGGAGG - Intronic
956512759 3:70012447-70012469 CGGACTTTAAAGATGAAGGAAGG + Intergenic
956618630 3:71198401-71198423 AGGATTTCCAAGATGGGGGGAGG + Intronic
957689621 3:83550995-83551017 AGAATTTTTAACATGAAGGGAGG + Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
958788960 3:98629567-98629589 AGGACTTGAAAGACGCAGGGTGG - Intergenic
959178477 3:102948416-102948438 AGAAAGTTAAAGATGGAGGCAGG - Intergenic
960037138 3:113113207-113113229 AGGATTTTAAATTTGGGGGCTGG + Intergenic
962088090 3:132212975-132212997 CGGGCTTTAAAGATGGAGGAAGG + Intronic
962089763 3:132230798-132230820 AATATCTTACAGATGGAGGGTGG - Intronic
962167355 3:133063356-133063378 AGGATTTTACAGAAGAAAGGAGG + Intronic
962228114 3:133633367-133633389 AGTATTTCAAAGAGGGAGGAGGG - Intronic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
963526665 3:146423778-146423800 CTGGTTTTAAAGATGGAAGGAGG + Intronic
963725466 3:148915708-148915730 AGCAATTTAAAGCGGGAGGGAGG + Intergenic
963765606 3:149333071-149333093 AGGATTTGAAAGAGGGATGGGGG - Intronic
964339912 3:155697610-155697632 AGGACTTGAAAGATGGAATGGGG - Intronic
965270275 3:166607601-166607623 AGGATTTCAAAGAAGGAGCCAGG + Intergenic
965297612 3:166969571-166969593 TGGAGTTTAAAGATGGACAGAGG + Intergenic
965676755 3:171205713-171205735 AGGGTTTTGAACATGGAGTGAGG - Intronic
966548616 3:181179976-181179998 AGAAAATTAAGGATGGAGGGAGG + Intergenic
966756148 3:183373468-183373490 AGAAATTGAAAGTTGGAGGGAGG - Intronic
967190493 3:186980457-186980479 TAGATTTTAAAGATAGAGGTCGG + Intronic
967650991 3:191986504-191986526 AGGTATGTAAAAATGGAGGGGGG - Intergenic
968283496 3:197494576-197494598 GGGATTTGAAACCTGGAGGGAGG + Intergenic
969342722 4:6552435-6552457 ATGGTTTTGAAGATGGAGGGAGG - Intronic
969424907 4:7118476-7118498 AGGAATGGAAAGATGGATGGAGG + Intergenic
971835943 4:31762804-31762826 AGGATTTATAAGAAGGAGGCAGG - Intergenic
972325387 4:38010657-38010679 AGGATATTGAAGATGGGGCGTGG - Intronic
974431854 4:61808482-61808504 AGGATTATTAAGATGAAGGGGGG + Intronic
975135611 4:70871356-70871378 AGAATTTTAAAAATTGAGGATGG + Intergenic
976008815 4:80462274-80462296 AGGAGTATAAAGGTAGAGGGAGG - Intronic
976010580 4:80483108-80483130 AGGTTCTTAAAGGTGGAGGAGGG + Intronic
976084018 4:81388812-81388834 AGTATTCTAGAGATGGAGGTGGG + Intergenic
976559278 4:86482470-86482492 ATGATTTGAAGGATGGTGGGGGG + Intronic
977246519 4:94637895-94637917 AGAATTCAAAAGATAGAGGGTGG + Intronic
977477812 4:97536046-97536068 AGGAGTTCAAAGCTGCAGGGTGG - Intronic
978044486 4:104109332-104109354 GAGATTCTAAAGAGGGAGGGTGG + Intergenic
978119824 4:105065202-105065224 AGGATTTGAAAGAGAGATGGCGG - Intergenic
978402516 4:108345574-108345596 AGCATTCTGAAGATGGATGGTGG + Intergenic
980407868 4:132377152-132377174 AAGATATTAAATATGGAGTGAGG + Intergenic
982044384 4:151428589-151428611 AGGATTTTAAAATGGGAAGGAGG - Intronic
982274466 4:153625113-153625135 GGGATTTTAAAAATGGAGGCCGG + Intronic
982488403 4:155997818-155997840 AGCATTTTGAAGATTTAGGGTGG + Intergenic
982767683 4:159367117-159367139 AGCATTTCAAGGCTGGAGGGTGG - Intergenic
982820376 4:159937447-159937469 AGCTTTTTAAAGATGAAGGCTGG - Intergenic
984364206 4:178777324-178777346 GAGATTTGAAAGATGGAGGCTGG + Intergenic
984622996 4:181974774-181974796 ATAATTTTAAAGAAAGAGGGTGG - Intergenic
986062487 5:4204732-4204754 AGGAATTAAAACAAGGAGGGGGG - Intergenic
987640607 5:20607025-20607047 TGGCTTTCAAAGATGGAGGAAGG + Intergenic
987969305 5:24921489-24921511 AGGAATTTAAAAATGAATGGTGG - Intergenic
989077207 5:37576140-37576162 TGGATTTTAGGGAGGGAGGGAGG - Intronic
990157981 5:52901197-52901219 TTGGCTTTAAAGATGGAGGGGGG + Intronic
990673235 5:58156163-58156185 AGGATGTGGAAGATGGAGAGGGG - Intergenic
991111919 5:62910062-62910084 TGGACTTTAAAGATGGAAGAAGG - Intergenic
991392735 5:66165786-66165808 GGGATTTTAAAGAAGGAGAAAGG + Intronic
992407780 5:76475972-76475994 AGGATGGGAAAGATGGAGTGGGG + Intronic
993458412 5:88152681-88152703 AGGAGTTGAAAAATGGATGGAGG - Intergenic
994218937 5:97172289-97172311 AGCATTTTGGAGTTGGAGGGTGG - Intronic
995825407 5:116292001-116292023 AATATTTTAAAGTTGGGGGGTGG - Intronic
995891988 5:116964692-116964714 AGCATCTTAGAGATGGAAGGAGG - Intergenic
995928616 5:117407686-117407708 AGTATGTTAAAGGTGGAGGGGGG - Intergenic
995969443 5:117950098-117950120 AGGATTTTCATTATGGAGGAAGG + Intergenic
996237960 5:121156744-121156766 AGGATTTTAAATAGGAAGAGAGG - Intergenic
997170274 5:131712345-131712367 AGGATTAGATATATGGAGGGTGG - Intronic
998494398 5:142574694-142574716 AGGATTTTTTTAATGGAGGGGGG + Intergenic
998920408 5:147061699-147061721 AGGACTTTGAAGATGGGGGTCGG + Intronic
999037554 5:148369984-148370006 GGGGTTTGAAGGATGGAGGGAGG - Intergenic
999062478 5:148651320-148651342 AGGATGGTAAAGTTGGAAGGGGG + Intronic
1001038937 5:168318418-168318440 AGCGTTCTAAAGATGGATGGTGG - Intronic
1001062224 5:168502088-168502110 AGGAATTTGAAGATAGAGGTAGG + Exonic
1001897562 5:175394476-175394498 AGGATTTTAATGAAGGAAGAAGG - Intergenic
1002488461 5:179556167-179556189 GCTATTTTAAAGATGGATGGTGG - Intronic
1002545158 5:179937527-179937549 ATAATTTTAAAAAAGGAGGGGGG + Intronic
1003027672 6:2571333-2571355 TGGACTTTGAAGATGGAGGAAGG - Intergenic
1003542880 6:7033492-7033514 AGAAATTTAGAGATGGAGAGAGG - Intergenic
1005047816 6:21658866-21658888 TGGAAATTAAAGATTGAGGGAGG + Intergenic
1006178203 6:32136452-32136474 AGGGTTTTCAAGCAGGAGGGAGG + Intergenic
1007633370 6:43284721-43284743 AGAATTTTAAAGATGAAATGAGG + Intronic
1008004107 6:46391774-46391796 AGGATTATGAAGGTGAAGGGGGG + Intronic
1008332952 6:50264241-50264263 AGCATTTTAGAGATGGTAGGTGG - Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009768860 6:68119308-68119330 AGGTTTTCAAAAATGGAGGGCGG + Intergenic
1010558293 6:77313714-77313736 ATGATTTGAAAGACGGAGGAAGG + Intergenic
1010793588 6:80093026-80093048 AGGGTTTTAAAGTTGGAAAGGGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011948895 6:92939559-92939581 ATTACTTTAAAGATGGAGGTGGG + Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1013097643 6:106960558-106960580 AGTATTTTAAAACTGGAGGCCGG + Intergenic
1013250641 6:108329597-108329619 AGTATTTTAAAGATTTAGTGGGG - Intronic
1013317322 6:108955199-108955221 AAGGTTTTAAAAATGGAGGCTGG + Intronic
1013855272 6:114564801-114564823 GGGATTTTAAAAAGGGAAGGGGG - Intergenic
1014273351 6:119359102-119359124 ATTATTTAAAGGATGGAGGGAGG - Intergenic
1015184785 6:130403000-130403022 AGGATTTGGAGGATGGAGAGTGG - Intronic
1015771637 6:136773955-136773977 TGGCATTTAAAGATGGACGGCGG - Intronic
1015917300 6:138230251-138230273 AGGGTTTTGAAGATGGGGAGGGG - Intronic
1016105809 6:140160515-140160537 AGGATTAAAAAGAAGGGGGGGGG + Intergenic
1016987669 6:149907356-149907378 AGGATTCCAAAGTGGGAGGGTGG + Intergenic
1017035371 6:150262428-150262450 AGGGTTATGAAGAAGGAGGGTGG - Intergenic
1018139933 6:160821193-160821215 AGGATTTCAAAAGGGGAGGGGGG - Intergenic
1018896369 6:168020803-168020825 AGGATTTAAAAGATGGAAAAAGG + Intronic
1019201767 6:170322418-170322440 AGGATTGTAAAGTGGGAGGCTGG + Intronic
1019695193 7:2441970-2441992 AGAATTTTGGAGATGGATGGTGG - Intergenic
1019761880 7:2818937-2818959 AGAATTCTAAAGATGGCCGGGGG + Intronic
1020716788 7:11684181-11684203 AGGATTTTTAACATGAAGGGAGG - Intronic
1020777564 7:12473698-12473720 AGGAGTTGGAAGATGGAGGGAGG - Intergenic
1021571241 7:22067391-22067413 AGGATTTGCAAGGTGGCGGGGGG + Intergenic
1022078769 7:26999355-26999377 AGGACTTGAAAGATGCAGGGGGG + Intergenic
1023469412 7:40498461-40498483 AGGATTTTAAAAAGGGGAGGGGG - Intronic
1023662182 7:42481054-42481076 AGTTTTTTAAAGATTGAAGGTGG - Intergenic
1026305252 7:69134758-69134780 AGGAAGTAAAAGAGGGAGGGGGG - Intergenic
1026434101 7:70379129-70379151 AGGATTTCAAAGATGGTTGAAGG - Intronic
1027177349 7:75913128-75913150 AATATTTTAAAGATGAAGAGTGG + Intronic
1027899295 7:84088925-84088947 AGGATTTTAAACAGTGAGGGAGG + Intronic
1028237702 7:88381862-88381884 AGGACTTGAAAGATGCAGGGTGG + Intergenic
1028345730 7:89779858-89779880 AGGCTTTTTCAGCTGGAGGGTGG - Intergenic
1028898283 7:96066347-96066369 AGGAATTTGAAGATTGGGGGTGG - Intronic
1028920310 7:96303520-96303542 AGGAAGATAAAGAAGGAGGGTGG - Intronic
1029524125 7:101084948-101084970 ATGAGTTTAAAGAAGGCGGGAGG - Intergenic
1030121799 7:106117379-106117401 AGGATTTTAAATTTGGAGCTTGG + Intergenic
1031109773 7:117594151-117594173 AGGATGTTAATGGTGGAGGTTGG + Intronic
1031150205 7:118045438-118045460 AGGATGTTAAAGATGGTGTTTGG + Intergenic
1031733776 7:125330914-125330936 GGCCTTTTAAAGGTGGAGGGTGG - Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032473726 7:132198338-132198360 AATATTTTAGAGTTGGAGGGTGG - Intronic
1032583467 7:133125344-133125366 AAGATTTCAAAGATGGTGGGAGG + Intergenic
1032610147 7:133403910-133403932 AGGATTTTAGAGACAGAGAGAGG - Intronic
1032890025 7:136184077-136184099 AGAGTTTTGAAGATGGAGGAAGG + Intergenic
1033414144 7:141147492-141147514 AGGAGTTCAAGGATGGAGGCTGG + Intronic
1033718932 7:144036203-144036225 AGCAAGGTAAAGATGGAGGGTGG - Intergenic
1034210045 7:149355652-149355674 AGCATTTTAAACATGAAAGGTGG - Intergenic
1036111413 8:5907147-5907169 AGGAATAGAGAGATGGAGGGAGG - Intergenic
1036567869 8:9953113-9953135 AGAATTTGAAAGAGGGAGTGTGG - Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1038127024 8:24685894-24685916 CTGGCTTTAAAGATGGAGGGAGG - Intergenic
1040844242 8:51820377-51820399 AAGCTTTTAAAGATTCAGGGAGG + Exonic
1041807218 8:61865263-61865285 TAGATTTTAATGATGGAGGGAGG - Intergenic
1042164470 8:65932286-65932308 ATGTTTTTAAAAATGGGGGGAGG + Intergenic
1042860687 8:73310146-73310168 AGGATTTTAAAGATTGCAGATGG - Intronic
1043371976 8:79605302-79605324 GGAATTTTAAAAATGAAGGGAGG + Intergenic
1043550849 8:81371095-81371117 AGGATTTAAAAAAGGGATGGAGG + Intergenic
1044256354 8:90067626-90067648 ACAATTTTAAAGATGGAACGGGG - Intronic
1044623912 8:94217769-94217791 AGGATTTTCAATATTGAGGGAGG - Intergenic
1044919989 8:97159212-97159234 AGAGTTTTAGAGATGGATGGTGG - Intergenic
1045593502 8:103626812-103626834 GGGATTTTAAAAGGGGAGGGGGG + Intronic
1046681475 8:117175301-117175323 AGCATATTAAAAATGGAGGCTGG - Intronic
1047085676 8:121512857-121512879 ATGTTTTTAAAGTTGGTGGGAGG - Intergenic
1049075278 8:140390947-140390969 AGGCTTTTTAAGATAGAAGGGGG - Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050752477 9:8956728-8956750 GGGATTTTTTAGAGGGAGGGAGG - Intronic
1051027345 9:12629017-12629039 AGAATTTTAATGATGGTGGAAGG - Intergenic
1051215055 9:14788787-14788809 AGAATTTCAAAGATGAAGAGTGG + Intronic
1051769456 9:20560663-20560685 AAGATTTTAAGGATTGTGGGCGG + Intronic
1051871105 9:21738691-21738713 AGGATTTGAAAGAAGTAGTGGGG + Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1052984722 9:34478398-34478420 AGAAGTTTCAAGAAGGAGGGAGG + Intronic
1053108850 9:35439087-35439109 GGGTTATTAAAGATGGAAGGAGG - Intergenic
1053201704 9:36156516-36156538 AGAATTCTAGAGATGGATGGTGG - Intronic
1053326316 9:37155061-37155083 AGACATTTAAAGATGGCGGGCGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054740651 9:68802885-68802907 AGGATTTTAAAGAAGGAGAGTGG + Intronic
1055326679 9:75137492-75137514 ACCATTTTTAAGATAGAGGGTGG - Intronic
1055348639 9:75362278-75362300 AGGGTTTCAAAGGGGGAGGGGGG + Intergenic
1055608013 9:77991551-77991573 AAGATTTTTAAGAAGGAGGGAGG - Intronic
1055889481 9:81107580-81107602 AGGAATTTTAAGAAAGAGGGTGG + Intergenic
1055895755 9:81173648-81173670 TGGATTTAAAAGATGGAAAGAGG + Intergenic
1056807865 9:89742836-89742858 AACGTTTTGAAGATGGAGGGTGG + Intergenic
1057867935 9:98696192-98696214 AGGATTTAAAAGATGAAGAAAGG + Intronic
1058282481 9:103132425-103132447 AGTACTTAAAAGATGGAGTGGGG - Intergenic
1058935296 9:109764307-109764329 AGGATGTACAAGATGGAGGGGGG - Intronic
1059625770 9:116064012-116064034 ACCATTTTAAAGAATGAGGGTGG - Intergenic
1060157297 9:121328759-121328781 GGGATTTTTAGGATGGAGGGAGG + Intronic
1060647269 9:125291668-125291690 GGGTTTTTAATGGTGGAGGGAGG + Intronic
1061915879 9:133753596-133753618 AAGAGTTTCAAGATGGGGGGTGG + Intergenic
1062651066 9:137578022-137578044 AAGATTTTAAAGTTGGCCGGGGG + Intronic
1203364523 Un_KI270442v1:245100-245122 AAGCTTTTAAAGATTCAGGGAGG + Intergenic
1186063955 X:5741671-5741693 AGCATTCTAAAGATGAAAGGTGG - Intergenic
1187405052 X:18996511-18996533 CGGATTCTAAATAGGGAGGGAGG - Intronic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188919051 X:35948942-35948964 AGAATTAAAAAGATGGAGGTGGG + Intronic
1189433145 X:40967578-40967600 AGGGTTTTAAACATACAGGGAGG - Intergenic
1189763822 X:44348897-44348919 AGCATTCTAAACAGGGAGGGGGG - Intergenic
1189835845 X:45021699-45021721 ATGATGTTAAAGAGAGAGGGAGG + Intronic
1191719367 X:64216682-64216704 AGGACTTAAAAGATGCAGGGTGG - Intergenic
1191870883 X:65743841-65743863 CCGATATTAAAGATGGAGGAAGG + Intergenic
1192370970 X:70512587-70512609 ACAATATTAAAGATAGAGGGTGG - Intergenic
1194257677 X:91654111-91654133 AGGAGTTTGAAGCTGGTGGGAGG - Intergenic
1194440607 X:93928959-93928981 AGGATTTCAAAAAGGGAGGGGGG + Intergenic
1194574507 X:95595306-95595328 AACATTTTGAAGATGGATGGTGG + Intergenic
1195980688 X:110575333-110575355 AGGATTTTATAGAATGAGAGAGG + Intergenic
1195982163 X:110590849-110590871 AAGATTTTAAAGAAAAAGGGAGG - Intergenic
1196192874 X:112812825-112812847 AGAATTTTGGAGATGGAGGCGGG - Intronic
1196731448 X:118944892-118944914 AGAATTCTAGAGATGGAGGGTGG + Intergenic
1197782830 X:130174007-130174029 GGGAATCTAAAGAAGGAGGGAGG + Intronic
1199340732 X:146674627-146674649 AGGATGGAAAAGATAGAGGGAGG - Intergenic
1200576334 Y:4893057-4893079 AGGAGTTTGAAGCTGGTGGGAGG - Intergenic
1201074123 Y:10174159-10174181 AAGCTTTTAAAGATTCAGGGAGG - Intergenic