ID: 1188001366

View in Genome Browser
Species Human (GRCh38)
Location X:24985601-24985623
Sequence TAGGATATTCAACCTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188001366 Original CRISPR TAGGATATTCAACCTGTACA AGG (reversed) Intronic
906932136 1:50180413-50180435 AGGGATACTCAACCTGTACTAGG + Intronic
911817984 1:102378616-102378638 GAGGATATTCAAAATGTGCAAGG + Intergenic
912531742 1:110329296-110329318 AAGGATGCTCAACCTGTACTGGG - Intergenic
913253374 1:116931052-116931074 AAGGATGCTCAACCTGTATAAGG - Intronic
919367502 1:196682217-196682239 TAGAAAATCCAATCTGTACAGGG - Intronic
919660273 1:200237300-200237322 AGGGATATTCAGCCTGTACCTGG - Intergenic
919710197 1:200719058-200719080 TAGGATAATCAACTTGTTGAAGG - Intergenic
920098367 1:203500798-203500820 TGGGATACTCAACCTGTACTGGG + Intronic
920654509 1:207865757-207865779 TGGGATAATAAACCAGTACAAGG + Intergenic
924698102 1:246420972-246420994 TAGGATATTATACTTTTACAAGG - Intronic
1063567247 10:7181411-7181433 AAGGATATTCAACATGTATTTGG + Intronic
1066005828 10:31145433-31145455 TATGATATTCTGCCTGCACATGG + Intergenic
1067185434 10:44023284-44023306 TGGGATGCTCAACCTGTATAGGG + Intergenic
1067496318 10:46763403-46763425 TAAGTGATTCATCCTGTACAAGG - Intergenic
1067598338 10:47576994-47577016 TAAGTGATTCATCCTGTACAAGG + Intergenic
1069766910 10:70868979-70869001 TAGGATAAACATACTGTACAAGG - Intronic
1070322748 10:75366599-75366621 TAGGATGTTTGAACTGTACAAGG + Intergenic
1071612725 10:87046268-87046290 TAAGTGATTCATCCTGTACAAGG - Intergenic
1078470972 11:11586468-11586490 TAGGAAATTCTACCTGTTCAGGG + Intronic
1079422385 11:20305831-20305853 TATGATGCTCCACCTGTACATGG + Intergenic
1081479780 11:43475179-43475201 AAGGATAATCAATCTGTACAAGG - Intronic
1085405963 11:76262352-76262374 TGGGATATTCCACCTGTAGGAGG + Intergenic
1085587720 11:77726871-77726893 GAGGATATACAACTTGTCCAGGG - Intronic
1088159195 11:106848417-106848439 TTGGATACTCAACATGTACCTGG + Intronic
1095231101 12:39741259-39741281 TATGTTATTCAAACTGGACATGG + Intronic
1097775874 12:63645204-63645226 TAAGATATTCAACTTGTCAAAGG + Intronic
1098460538 12:70728419-70728441 AGGGATACTCAACCTGTACTGGG + Intronic
1102378375 12:112442258-112442280 AGGGATACTCAACCTGTATAAGG - Intronic
1102485730 12:113254565-113254587 AGGGATATTCAACCTGTATATGG - Intronic
1102835254 12:116051514-116051536 AAGGATATTCAGCCTGTACTTGG - Intronic
1104577951 12:129985339-129985361 AGGGATATTCAGCCTGTACTTGG - Intergenic
1107323888 13:39219344-39219366 AAGGATATTGAAGCTGGACATGG + Intergenic
1107867698 13:44718979-44719001 AGGGATATTCAACCTGTATTAGG - Intergenic
1110753193 13:79139873-79139895 TAGTATATTCAACCAGTATAAGG + Intergenic
1111281766 13:86035099-86035121 TAGGATAATCAAACTATAGAAGG + Intergenic
1118984985 14:70746364-70746386 TAGGAGATTCAACATGTCTAAGG - Intronic
1119209763 14:72822853-72822875 TGGGATGTTCAACCTGTAGGGGG - Intronic
1127468046 15:59264233-59264255 AAGGATACTCAGCCTGTACAGGG + Intronic
1128180382 15:65597961-65597983 GGGGATACTCAACCTGTACTAGG - Intronic
1128674556 15:69599125-69599147 TCTGAAATTCAACTTGTACAGGG - Intergenic
1135514313 16:23116926-23116948 AGGGATACTCAACCTGTACCAGG - Intronic
1137944994 16:52725553-52725575 TAGGTCATTCAACCAGTAAATGG - Intergenic
1140486554 16:75298265-75298287 AGGGATATTCAACCTGTATCTGG + Intronic
1146550866 17:33779512-33779534 TAGGTTATTCATTCTGAACACGG - Intronic
1147005126 17:37396743-37396765 TAGGACTCTCAACCTGTCCAGGG - Intronic
1148985746 17:51619519-51619541 TGGGATACTCAACCTGTAGTAGG - Intergenic
1150837396 17:68576808-68576830 TAGGCTATTCAAAATGAACAGGG - Intronic
1150889257 17:69127382-69127404 TCGGATGTTCAACATGTATAAGG + Intronic
1156107021 18:33675676-33675698 CAAGATATTCACCCTGTGCAAGG + Intronic
1158359929 18:56660536-56660558 AAGGATACTCAACCTATAGATGG + Intronic
1159290892 18:66417962-66417984 TCGGATTTTCTACCTGTCCAGGG - Intergenic
1159487485 18:69083065-69083087 TAGGATATTAAAACTTTAGATGG + Intergenic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
928522841 2:32107177-32107199 AGGGATATTCAACTTGTACTAGG - Intronic
928642779 2:33318195-33318217 AGGGATACTCAACCTGTATATGG + Intronic
932060044 2:68487612-68487634 TTGGATATTCACTCTGTATAAGG + Intronic
933788232 2:85861168-85861190 TGGGATATCTAACCTTTACATGG + Exonic
935613540 2:105052050-105052072 TAGGATATTTCACCTGAAAATGG + Intronic
939681155 2:145134827-145134849 TAGGATTTGCCACTTGTACATGG - Intergenic
942810932 2:180000278-180000300 AAGGATTTTCAACCTGTACCTGG - Intronic
943771771 2:191725313-191725335 TAGGATATTCAAGGAGTACCAGG + Intergenic
944285548 2:197946016-197946038 TAGCATAGTCAAATTGTACATGG - Intronic
945584402 2:211640545-211640567 TAGGTTATACAACTTGTCCAAGG + Intronic
946527046 2:220531886-220531908 AAGGATACTCAACCTGCATAAGG + Intergenic
1177380117 21:20329300-20329322 TAGGAAATTTCACCTTTACAAGG + Intergenic
1177658602 21:24052518-24052540 TAGGATATTGAACATGTCCTGGG - Intergenic
1182771068 22:32796792-32796814 TTGGAAATTCAACCTGGAGAAGG - Intronic
950986835 3:17381051-17381073 TAGGATTTTAAACATGTACAGGG + Intronic
951005116 3:17606684-17606706 TATAATATTAAACCTTTACAAGG + Intronic
951330324 3:21359982-21360004 TAGTATATGAAACCAGTACAAGG + Intergenic
952449177 3:33414876-33414898 TAGTATATTCCACCTAGACAAGG - Intronic
953238722 3:41128732-41128754 TAGGTTCTCCAACTTGTACATGG - Intergenic
953936135 3:47045043-47045065 AGGGATACTCAACCTGTACGCGG + Intronic
957269065 3:78005079-78005101 TAAGCTATTCAACATGTACGGGG + Intergenic
959874085 3:111361198-111361220 GAGGATATTCAGCCTATAAAGGG - Intronic
963738061 3:149043790-149043812 TAGGTTAAGCAACCTGTCCAAGG - Intronic
963775139 3:149431342-149431364 TAGTATATTCAACCTGAGAAAGG + Intergenic
966677431 3:182604492-182604514 TAGGATATTAAAGGTGTATAGGG - Intergenic
969863425 4:10055575-10055597 CAGGATATTCAACCTTGCCAGGG - Intergenic
970726966 4:19058773-19058795 TAGGATATTGAATATATACAAGG - Intergenic
972108400 4:35523861-35523883 TAGGGTATTCAACATGTTAAAGG - Intergenic
974810043 4:66934311-66934333 CAGGATATTCAAGCAGTTCATGG + Intergenic
975417404 4:74120908-74120930 TGACATATTCAACCTGTTCAGGG + Intronic
979163087 4:117488932-117488954 AAGGATGTTCAACCATTACATGG + Intergenic
979580743 4:122356438-122356460 AAGGATACTCAATCTGTACTAGG + Intronic
979772192 4:124541188-124541210 TCAGATACTCAACCTGTATAAGG - Intergenic
981115165 4:140981185-140981207 AAGGATACTCAACCTGTAGTTGG - Intronic
982080297 4:151783212-151783234 TAGGGTATTCACCCAGGACAGGG - Intergenic
983563728 4:169127848-169127870 AGGGATATTCAACCTGTAGTGGG - Intronic
986798440 5:11234885-11234907 CAGGAGTTTCAACCCGTACAAGG + Intronic
988797065 5:34661044-34661066 AAGAATACTCAACCTATACACGG - Intronic
997946397 5:138205982-138206004 AGGGATACTCAACCTGTACTAGG + Intronic
999219908 5:149966540-149966562 AGGGATACTCAACCTGTACTGGG - Intronic
1000123050 5:158216192-158216214 TTAGATATTCCAACTGTACAAGG - Intergenic
1000671222 5:164065582-164065604 TAAGATACTCAACCTTTACCAGG + Intergenic
1001346526 5:170905126-170905148 TTGGATTTTTACCCTGTACAAGG + Intronic
1001468920 5:171994584-171994606 AGGGATACTCAACCTGTATAAGG + Intronic
1001480316 5:172084698-172084720 AAGGATACTCTACCTGTATAAGG - Intronic
1006612732 6:35304338-35304360 GAGGATATTCCACCTGGTCAGGG + Intronic
1007534076 6:42568771-42568793 AACAATACTCAACCTGTACATGG - Intronic
1007668402 6:43530812-43530834 TAGGATATGAAAACTGTAAAGGG + Exonic
1014984775 6:127990768-127990790 TAGGACATTCACCCTGGAAAGGG - Exonic
1015536780 6:134274495-134274517 TAAGATGCTCAACCTGTACTTGG - Intronic
1015656458 6:135524607-135524629 TTGGAAATCCAACCTGAACAGGG - Intergenic
1015844563 6:137506619-137506641 GATAATATTCAGCCTGTACAGGG + Intergenic
1016555347 6:145330073-145330095 TGGGATGTTCAACCTGTACTGGG - Intergenic
1016603406 6:145889755-145889777 AGGGATGCTCAACCTGTACAAGG + Intronic
1016651868 6:146470990-146471012 AAGAATATTCATCCTCTACACGG + Intergenic
1020340012 7:7100053-7100075 TAGTTTATTTAAACTGTACATGG - Intergenic
1020408748 7:7866853-7866875 TAGGGTAGTAAAGCTGTACATGG + Intronic
1022363843 7:29689438-29689460 TAGAATATTCAACTTGTCAAAGG - Intergenic
1022697524 7:32724301-32724323 TAGAATATTCAACTTGTCAAAGG + Intergenic
1022934775 7:35162799-35162821 TAAGATATTCAACTTGTCAAAGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024154364 7:46605275-46605297 TAGACTCTTCCACCTGTACACGG - Intergenic
1024558488 7:50623764-50623786 AGGGATATTCAACCTGTATAAGG - Intronic
1024946424 7:54812252-54812274 TATGATTTTCAAACTCTACATGG - Intergenic
1029296809 7:99546803-99546825 TAGGATTTTCAATCTTGACACGG - Exonic
1030616832 7:111746098-111746120 AAGGATACTCAACCTGTAACTGG + Intronic
1031131427 7:117837484-117837506 TGGGATCTTCAACCTGTAGTTGG - Intronic
1031311451 7:120203111-120203133 TAGCATATTAAACCTATATAAGG - Intergenic
1034756763 7:153629126-153629148 AAGGATGTACAAGCTGTACAAGG - Intergenic
1036071327 8:5442976-5442998 AAGGATATTCAGCATATACAAGG - Intergenic
1039374334 8:37018270-37018292 AAGGGTACTCAACCTGTATATGG + Intergenic
1042569725 8:70149971-70149993 TAGCATATCCAACCTCTGCATGG - Intronic
1043076038 8:75700665-75700687 TGGGATACTCAACCTGTATCTGG + Intergenic
1045836939 8:106533674-106533696 TATGATATGCTACCTGAACAGGG + Intronic
1048683893 8:136879743-136879765 TGGGATGATCAACCTGTAAAAGG + Intergenic
1050064378 9:1743457-1743479 AAGGATATTGAGCATGTACAAGG - Intergenic
1051145558 9:14023613-14023635 TAGGGTATTTGACCTGTTCAGGG - Intergenic
1054894869 9:70297534-70297556 AGGGATATTCAACCTGTAATAGG + Intronic
1055115487 9:72601010-72601032 AGGGATATTCAACCTGTATTTGG - Intronic
1060123102 9:121014466-121014488 TAGGATATTCAGCTTGAAGAAGG - Intronic
1186730675 X:12406137-12406159 TAGGATGTTCAACATGTCCCTGG - Intronic
1188001366 X:24985601-24985623 TAGGATATTCAACCTGTACAAGG - Intronic
1188566997 X:31537852-31537874 TGAGATATTCAACCTATAGATGG - Intronic
1198591902 X:138192833-138192855 TAGGATATTTAACCTTTGGAAGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199070848 X:143473830-143473852 TAGAATCTTCAACATATACATGG - Intergenic