ID: 1188002442

View in Genome Browser
Species Human (GRCh38)
Location X:24995103-24995125
Sequence CTCTGGGAAGGGAAAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1213
Summary {0: 1, 1: 0, 2: 12, 3: 142, 4: 1058}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188002442 Original CRISPR CTCTGGGAAGGGAAAGGAGA GGG Intronic
900387928 1:2419115-2419137 CGCAGGGAAGGGCAAGGAGCTGG - Intergenic
900737590 1:4308903-4308925 CTATGGGAAGGGAGAGGGCAGGG - Intergenic
900800435 1:4733748-4733770 TTGTGGGCAGGGATAGGAGAAGG + Intronic
900890695 1:5447745-5447767 CTCAGGGAAGGGACAGGACAGGG + Intergenic
900931337 1:5739755-5739777 GTCTGGGATGGGAAAGGCCAGGG + Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901616467 1:10543841-10543863 CTTTGGGAAGGCAAGGCAGAAGG - Intronic
902087097 1:13871809-13871831 TTCTGGGAAGTGGGAGGAGATGG + Intergenic
902101370 1:13992681-13992703 CTCTGGGAAGGTAAAGAGCAGGG + Intergenic
902167177 1:14581929-14581951 GTGTGGGAAGGGGAAAGAGAGGG - Intergenic
902516261 1:16991326-16991348 CTTTGGGAGGCCAAAGGAGAAGG - Intronic
902615441 1:17621063-17621085 ATGGTGGAAGGGAAAGGAGAAGG + Intronic
902652079 1:17843667-17843689 AGGTGGGAAGTGAAAGGAGAAGG - Intergenic
902718431 1:18288725-18288747 CTCTCGGAAGGCAAAGGAAATGG - Intronic
902772880 1:18656012-18656034 CACTGGCAAGGCTAAGGAGAGGG - Intronic
902885231 1:19400107-19400129 CTCCTGGAAGAGAAAAGAGAAGG - Intronic
903358748 1:22763839-22763861 CTCTAGAAAGGGCAAGGACATGG - Intronic
903743805 1:25573533-25573555 CACAGGGAAGGGAAGGGAAATGG + Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904621047 1:31775572-31775594 CTCTGGAAAGGGTCTGGAGAAGG - Intergenic
904683767 1:32246717-32246739 CCCTGGGAGGGGCAGGGAGATGG + Intergenic
904713261 1:32447766-32447788 CTAGGGGAAGGGGAAGGAGGGGG - Intergenic
905052409 1:35063062-35063084 CTCTTGGAGAGGAAAAGAGAGGG + Intronic
905119012 1:35667418-35667440 GTCAGGGAAGGGACAAGAGATGG - Intergenic
905169604 1:36101543-36101565 AGCTGGGAAGGGGAAGGGGAAGG - Intronic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905511879 1:38528280-38528302 GGCTGGGAAAGGGAAGGAGATGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905880216 1:41458178-41458200 CTCTGCGATGGGAGAGGAGGAGG + Intergenic
906170012 1:43717072-43717094 CTCTGGGAAGCTGAAGCAGAAGG - Intronic
906507694 1:46392655-46392677 CTAGGGGAAGGGGAAGGAGAGGG - Intergenic
906911828 1:49960407-49960429 CGCTGGTAAGGGTAGGGAGAAGG + Intronic
907108414 1:51904964-51904986 CTATGGCAAAGGAAAGGAAAAGG + Intergenic
907241224 1:53082101-53082123 CTTGGGGAAGGAAAAGGAGGAGG + Exonic
907267080 1:53269011-53269033 CTCTGAGTAGGGAAGGGACATGG - Intronic
907320609 1:53599921-53599943 CTCTCAGAAGGCAAAGCAGAAGG + Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
908387163 1:63653688-63653710 CGCTGGGGAGGAAAAAGAGAGGG + Intronic
908474782 1:64476796-64476818 CTTGGGGGAGGGAGAGGAGATGG + Intronic
908505836 1:64799085-64799107 GTCTGGGAAGAGAAGGGAGAAGG - Intronic
910846124 1:91606251-91606273 CTCTGGAAGGGCAAAGGAGCAGG + Intergenic
911509861 1:98798444-98798466 GTCTGGGAAGGGAAGAGGGAAGG - Intergenic
911642843 1:100307237-100307259 CTCTAGGAAAGGAAAAGAGAAGG - Intergenic
911686966 1:100788600-100788622 TTGTGGGAGGGGAAAGGAAAAGG - Intergenic
912259836 1:108099387-108099409 GACTGGGAAGGGAAGGTAGAAGG - Intergenic
912323302 1:108734727-108734749 CTATGGGAAGGGACAGGAATAGG + Intronic
912509434 1:110178517-110178539 CTTTGGGAAGGGAAGGGAATGGG - Intronic
912839380 1:113025536-113025558 CTTTGGGAAGCCAAAGCAGATGG + Intergenic
912976203 1:114332479-114332501 ATCTATGAAGGGAAAGGACAGGG - Intergenic
913161944 1:116152654-116152676 CACGGGGAAAGGAAAGGAAAGGG + Intergenic
914240533 1:145849877-145849899 CTCAAGGCAGGGAAAGGGGAAGG - Intronic
914356235 1:146887060-146887082 ATCTGGGAGGGGGAAGAAGAGGG - Intergenic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915715354 1:157940031-157940053 CTCTAGGGAGGGAAATGAGCTGG - Intergenic
915791624 1:158678245-158678267 CTTTGGGACAGCAAAGGAGAAGG - Intronic
915962368 1:160277897-160277919 CTCTGGTAAGGTATAGGAGTTGG + Exonic
915971892 1:160360951-160360973 CTCAGGGAAAGGAAAGGGGCTGG - Intergenic
916018113 1:160768302-160768324 GTCTGGGAAGAGAAAAGTGAAGG - Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916551148 1:165851005-165851027 CTCTGGGAGGGCAAAGGGGGAGG - Intronic
916686539 1:167152330-167152352 CTCTGCGGTGGGAAGGGAGAAGG - Intergenic
917241044 1:172949136-172949158 CTCTGTGGAGGGAAAGCCGAGGG - Intergenic
917638460 1:176959426-176959448 GTATGGGAAGAGAAAGGAGCAGG - Intronic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
918438510 1:184541985-184542007 TTCTGGGAAAGGAAGGGCGAAGG + Intronic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919034503 1:192289280-192289302 GGCTGGGAAGGGAAGGGGGAGGG + Intergenic
919470588 1:197974292-197974314 CTGAGGGCAGGGAAAGTAGAAGG + Intergenic
919816396 1:201443480-201443502 CTCAGGGAAGGAAAAGGTAAGGG + Intergenic
919936104 1:202251834-202251856 CACCTGGAAGGGAGAGGAGATGG + Intronic
920081208 1:203374055-203374077 CTCAGGGGAGGGAAAGGAGGAGG + Intergenic
920205651 1:204289339-204289361 CTCTGGGGCCTGAAAGGAGAAGG - Intronic
920551786 1:206867654-206867676 CTCTGGAAATGGAAAGGGAATGG + Intronic
920688361 1:208127159-208127181 CTTTGGGAAGTCCAAGGAGATGG + Intronic
920812166 1:209296463-209296485 CCCCGGAAAGGGAAAGGAGAGGG + Intergenic
920935986 1:210435125-210435147 GGCTGGGAAGGGAAAGCAGGAGG - Intronic
921092852 1:211859679-211859701 CTATGGGTAGGAAAAGCAGAGGG + Intergenic
921713392 1:218395091-218395113 TTCTGGAAAGGGAAATGAGGGGG + Intronic
921964763 1:221076485-221076507 CTTTATGAAGGGAAAGGAAAGGG - Intergenic
922144443 1:222925593-222925615 ATCTTGGAAGGAAAAGGACAGGG - Intronic
922233296 1:223704639-223704661 CTGAGGGAAGGGAAATGAGAAGG + Intronic
922523762 1:226281264-226281286 GGCTGGGAAGGGAAAAGGGAGGG + Intronic
922806221 1:228391420-228391442 ACCTGGGAAGGGACAGGACATGG + Intergenic
922854155 1:228759947-228759969 CTCAGGGATGGCAAAGGTGAAGG + Intergenic
922934283 1:229411493-229411515 CTCTGGGGCTGGAAAGGGGAGGG - Intergenic
922985644 1:229864234-229864256 CCCTGTTAAGGGGAAGGAGAAGG - Intergenic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923250278 1:232174181-232174203 CTATGGCAAGGTAACGGAGATGG - Intergenic
923401837 1:233623274-233623296 ATCTGGGAAGGGTACGGGGAGGG + Intronic
923701342 1:236303068-236303090 GGCTGGGAAGAGAAAGGAGTGGG + Intergenic
924157946 1:241200684-241200706 CTCATGGAAGCTAAAGGAGAGGG - Intronic
924450593 1:244175342-244175364 GTCTCGAAAGGGAAAGGATAGGG - Intergenic
924457570 1:244230853-244230875 TGCTAAGAAGGGAAAGGAGAGGG + Intergenic
924494698 1:244575739-244575761 CTAGGGGAAAGGGAAGGAGAGGG - Intronic
924574083 1:245263305-245263327 CACTCGGAAGGGAAGGCAGAGGG + Intronic
924598625 1:245468355-245468377 GTCTGGGAAGGGGACAGAGAGGG - Intronic
1062906137 10:1180614-1180636 CCCTGGGTAGTGAAAGGAGAAGG - Exonic
1062907318 10:1187571-1187593 CTCCGCAAAGAGAAAGGAGAGGG - Intronic
1063956581 10:11273084-11273106 GTGTGGGCAGGGAATGGAGAGGG + Intronic
1064152216 10:12874591-12874613 CTCTGCAAAGGGAGAAGAGAAGG - Intergenic
1064276292 10:13908313-13908335 TTCTGGGGAGGGAATGGGGAGGG - Intronic
1064365953 10:14708030-14708052 GGCTGGAAATGGAAAGGAGAGGG - Intronic
1064507192 10:16045172-16045194 CTCTAGGAAAAGAAAGTAGATGG + Intergenic
1065012601 10:21432893-21432915 CTCTGGGAAGGGACTAGAGAGGG + Intergenic
1065452657 10:25874590-25874612 GGATGGGAAGGGAAGGGAGAAGG + Intergenic
1066494960 10:35933705-35933727 CTCTGAGCAAAGAAAGGAGAGGG - Intergenic
1066500979 10:35994366-35994388 CTCTGCTAAGGAAAAGGAAAAGG - Intergenic
1067189718 10:44059250-44059272 CTCTGGGAAGGTAACTGAGCAGG + Intergenic
1068008513 10:51419282-51419304 CTCAAGGAAGTGAAGGGAGAAGG + Intronic
1068248349 10:54403597-54403619 CTCAGGCAAGGGAAAGAAAAAGG + Intronic
1068309874 10:55263455-55263477 AACTGGGAAGGGAAAGGGAAAGG - Intronic
1069100377 10:64312688-64312710 CTCTGGGTAGGTGAAAGAGAAGG + Intergenic
1069216144 10:65823761-65823783 CTCTGGGGAGAGGAAAGAGAAGG + Intergenic
1069316986 10:67117370-67117392 AACAGGAAAGGGAAAGGAGATGG - Intronic
1069763827 10:70836569-70836591 CTCAGGAAAGGGAAAGGGAAAGG - Intronic
1069931177 10:71882721-71882743 CTCTGGGCAGGCCAAGGAGGAGG + Intergenic
1070145906 10:73773058-73773080 CGGAGGGAAGGAAAAGGAGAGGG + Intronic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1071586840 10:86831510-86831532 CTCTGGGAAGCCAAGGCAGAAGG + Intronic
1071618830 10:87099434-87099456 CTCTGCCAAGTGAAAGAAGACGG - Intronic
1072007721 10:91270491-91270513 CTCTTTGGAGAGAAAGGAGAAGG + Intronic
1072181264 10:92983282-92983304 ATGGGGAAAGGGAAAGGAGAGGG - Intronic
1072628884 10:97132206-97132228 GTCTGGGAAGACAAAGGAGGAGG - Intronic
1072744717 10:97932066-97932088 AGCGGGTAAGGGAAAGGAGAAGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073139099 10:101236139-101236161 TTCTGGGGATGGCAAGGAGAAGG - Intergenic
1073478844 10:103772766-103772788 CTCTGGGAGGGGCGAGGAGCCGG - Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073755120 10:106573034-106573056 CTGTGGGAATGGAAAGGTTAAGG + Intergenic
1073890028 10:108090764-108090786 CTCTGCTTAAGGAAAGGAGAAGG + Intergenic
1074062628 10:109981300-109981322 ACCTGGAAAGGGAAAGGGGATGG + Intergenic
1075010717 10:118867550-118867572 CCCTGGGAAGGCGAAGGGGAAGG + Intergenic
1075334827 10:121601062-121601084 TGATGGGAAGAGAAAGGAGAAGG + Intergenic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076274126 10:129182235-129182257 CCAGGGGAAGGGAAGGGAGAGGG - Intergenic
1076639530 10:131904712-131904734 CTCTGCAATGGGTAAGGAGAAGG + Intronic
1077028408 11:451914-451936 CCCTCGGGAGGGAGAGGAGATGG + Intronic
1077398200 11:2336991-2337013 CTAGGGGAAGGGGAAGGAGAAGG + Intergenic
1078197987 11:9152654-9152676 TACTGGGAATAGAAAGGAGATGG + Intronic
1078212971 11:9286106-9286128 CTCAGGGAAGAGGAAGGGGAAGG + Intronic
1078459283 11:11501059-11501081 CTCTGTGAGTGGAAACGAGAGGG - Intronic
1078722335 11:13896652-13896674 TACTGTGAAGGAAAAGGAGAGGG + Intergenic
1078764551 11:14281988-14282010 TTCTGGGAAGGGAAAGTGTAAGG + Intronic
1079193229 11:18299965-18299987 TTCTGGGAAGGGTAAGAGGAAGG + Intronic
1079307354 11:19334848-19334870 CTCTGAGGAGGTAAATGAGATGG - Intergenic
1080173734 11:29337461-29337483 CTGTGGGATGGGCAAGGAAAGGG + Intergenic
1080728771 11:34924927-34924949 CACTGGGGAGGGAAAACAGAGGG - Intronic
1081738860 11:45424269-45424291 CTAGGGGGAGGGAGAGGAGAAGG - Intergenic
1081825837 11:46050562-46050584 CTCTGGGAGGGGAATGAAGTAGG + Intronic
1083052172 11:59787273-59787295 CTCAGGTAAGGTAAAGGGGAGGG - Intronic
1083058884 11:59848948-59848970 CACTGGCCAGGGAATGGAGAAGG - Intergenic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1083431650 11:62616488-62616510 CTCGGGTAAGGGAATGGAGATGG - Exonic
1083592666 11:63904590-63904612 CTCGTGGAAGTGGAAGGAGATGG - Intronic
1083711002 11:64548250-64548272 CACTGGTAGGGGAAATGAGATGG + Intergenic
1083742199 11:64716922-64716944 CGCAGGGAGGGGAAAGGCGAGGG - Intronic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084923926 11:72496275-72496297 GGCTGGGAAGGGAAGGGGGAAGG + Intergenic
1085017726 11:73186136-73186158 CTCTGCCAAGGGAAAGGTGGTGG + Intergenic
1085037214 11:73307840-73307862 CTCTGGGCCGGGAAAGGGGTGGG - Intergenic
1085151142 11:74253732-74253754 TACAGGGAAGGGAAAGGAGCAGG - Exonic
1085214647 11:74818175-74818197 CCCTGGGAAGGAAAGGAAGAGGG + Intronic
1085263670 11:75223876-75223898 TACTGGGAAGGAAAAGGAGAGGG - Intergenic
1085709295 11:78814394-78814416 CTCTGGGGAGAGAAAGGAGAAGG + Exonic
1085740907 11:79077704-79077726 CTCTGGGGAGGGAAAGAGGTTGG + Intronic
1085859923 11:80221164-80221186 GGCTGGGAAGGGTGAGGAGAAGG + Intergenic
1086118607 11:83282620-83282642 CCCTGAGAAGGGAAAGCACATGG - Intronic
1086166312 11:83782844-83782866 TTCTGGGAAGGGTAAGGAAAGGG + Intronic
1086874748 11:92082049-92082071 GTCTGGGAAGGTAAGGGAGTGGG + Intergenic
1087198002 11:95319803-95319825 CTCTGGGAAGTGAAGGCAGGTGG + Intergenic
1087268990 11:96092295-96092317 TTCTGGGAAGGCAAAACAGAAGG + Exonic
1087461845 11:98456038-98456060 ATCTCGGAGGGGAAAGGATAAGG + Intergenic
1087640266 11:100749073-100749095 CCTAGGGAAGGGGAAGGAGAGGG - Intronic
1087689189 11:101299458-101299480 CTCTGGGAAGGAGAGGGAGGTGG - Intergenic
1088095849 11:106100677-106100699 CCCTGGAAAGGGAAAGATGAAGG - Intergenic
1088258511 11:107923621-107923643 CGAGGGGAAGGGGAAGGAGAAGG - Intronic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089215007 11:116829949-116829971 CTCTGGGGAGGGGAAAGAGGAGG + Intronic
1089418566 11:118314186-118314208 ATAGGGGAAGGGAAAGGAAAAGG - Intronic
1089590121 11:119534683-119534705 ACGTGGGCAGGGAAAGGAGAGGG - Intergenic
1089637294 11:119823375-119823397 CTCTGGGAGGTGCAGGGAGAGGG + Intergenic
1089720404 11:120413758-120413780 TTCAGGGAAGGGAGTGGAGAAGG - Intronic
1089739899 11:120575316-120575338 GGCTGGGCAGGGAAAGGGGAGGG - Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1090383536 11:126343487-126343509 CTCTGGGAAAGGTGAGGAAAGGG - Intronic
1090880665 11:130829166-130829188 TAATGGGTAGGGAAAGGAGAGGG + Intergenic
1091032629 11:132204668-132204690 CTGTGGGAAGAGCATGGAGAGGG + Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091305567 11:134533783-134533805 CTCAGGGAAGGAAATGGAAAGGG + Intergenic
1091519609 12:1224116-1224138 CTCTGGGAAGAGATATAAGAGGG - Intronic
1091724243 12:2834583-2834605 ATCTGGGAAGTGGAAGGAAAAGG + Intronic
1091764344 12:3108727-3108749 CTCCAGGAAAGGAAAGGAGGGGG - Intronic
1092005290 12:5064231-5064253 CATTGGGAAGAGAAAGAAGAAGG + Intergenic
1092171799 12:6378117-6378139 CTTTGGGGAGGGAAAGGAAGGGG - Intronic
1092700976 12:11230528-11230550 GGCTGGGAAGGGAAGGGGGAAGG - Intergenic
1092906328 12:13103164-13103186 CCCTGGGAACAGAAAGGAGAAGG + Intronic
1092938289 12:13384507-13384529 CCATGGGAATGTAAAGGAGAGGG - Intronic
1092942740 12:13425710-13425732 ATTAGGGAAGGGAAAGGAAAAGG - Intergenic
1093488152 12:19675276-19675298 GGCTGGGAAGGGAAGGGAGAAGG - Intronic
1093823933 12:23658544-23658566 TTCTGGGAAGGCAGAGGAGAGGG + Intronic
1093824787 12:23670634-23670656 TTATGGGTAGGGAAAGGGGAAGG + Intronic
1094055848 12:26269002-26269024 CTCTGGGGAGGGAAAAGGGGTGG - Intronic
1094311178 12:29085679-29085701 CTCTGGAAGGGGCAAGCAGAGGG + Intergenic
1094408600 12:30146183-30146205 CTCTGGAAAGGGCAAGGATATGG + Intergenic
1094433564 12:30397154-30397176 CTCTGAGATGAGAAAGGAGAAGG + Intergenic
1094556648 12:31506982-31507004 CTCTGGAGAGGGAAAGGAGTTGG - Intronic
1094654686 12:32408944-32408966 CTCTGGGAAGGTTCAGCAGAGGG + Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095434599 12:42173674-42173696 ATCTTGGATTGGAAAGGAGAAGG - Intronic
1095517646 12:43024233-43024255 CTTTGGGGAGGGTCAGGAGAGGG + Intergenic
1095938339 12:47709214-47709236 CTCTGGGAAAGGGCAGGACAAGG + Intergenic
1096067568 12:48753354-48753376 CTCAGGGAAGGGAAATGATAAGG - Intergenic
1096319497 12:50598895-50598917 CAATGGGAAAGGATAGGAGAGGG - Intronic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1096660020 12:53118486-53118508 CTCAGGGAGGGGAGAGTAGAAGG - Intronic
1096805799 12:54140490-54140512 CCCTGGGAAGGGAAAGGAAAGGG + Intergenic
1096805903 12:54141014-54141036 CTCTGTGGAGGGAAAGCTGAGGG - Intergenic
1097180846 12:57171047-57171069 CTCTGTGAAGGGGAGGGTGAGGG + Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097296056 12:57964344-57964366 TTCTGGGAAGATAATGGAGAAGG + Intergenic
1097377139 12:58855065-58855087 CTTTTGGTAGGGAAAGGAGGTGG + Intergenic
1097751552 12:63360036-63360058 GTAGGGGAAGGGAAAGGAGAGGG - Intergenic
1097927240 12:65142485-65142507 CTCTGGAAACGGAAAGGGCAAGG + Intergenic
1098119893 12:67225201-67225223 CTCTGGGGAGAGGAAGCAGATGG + Intergenic
1098366757 12:69711822-69711844 CTCTAGGAAGGGAAAGGGCCAGG - Intergenic
1098397457 12:70036209-70036231 CTTTGGGAAGAGAAAAGAGCGGG - Intergenic
1098457837 12:70695586-70695608 ATCTGGGCAGGAAATGGAGAAGG + Intronic
1099200583 12:79672164-79672186 CTCTGTGTACGGGAAGGAGAGGG - Intronic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1099491110 12:83289430-83289452 AAATGTGAAGGGAAAGGAGAAGG + Intergenic
1099924153 12:88997009-88997031 CATTGGAAAGGGAAAAGAGAGGG + Intergenic
1099993410 12:89751638-89751660 ATCTGGGAGGGTAAAGGAGTAGG - Intergenic
1100715846 12:97304314-97304336 TTCTGGGAAGGGCTGGGAGATGG + Intergenic
1100959448 12:99946172-99946194 CTCTGAGTGGGGAAAGGAGGAGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101590804 12:106123635-106123657 CTCTGGGAATTGAAAGAACAAGG + Intronic
1102003967 12:109576977-109576999 CTGGGGTCAGGGAAAGGAGAAGG - Intronic
1102006508 12:109592420-109592442 GTCAGTGAAGGGACAGGAGAGGG + Intronic
1102049578 12:109852864-109852886 GTGTTGGAAGGGAAAGGAAAAGG + Intronic
1102432898 12:112897498-112897520 ATCATGGAAGGGAAAGAAGAGGG - Exonic
1102463943 12:113117089-113117111 CTCTGGGAAAGGGCAGGAGGCGG + Exonic
1102663968 12:114554243-114554265 CTTTGGGAAAGGAAAGGGGCTGG - Intergenic
1102908266 12:116694017-116694039 CTCTGGAACGGAAGAGGAGAGGG + Intergenic
1103161008 12:118729375-118729397 CTCTGGGAAGGTGAAGGTGTTGG + Intergenic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1103967969 12:124652241-124652263 GTCTGGGATGGGAGAGGAAAAGG - Intergenic
1104499298 12:129269384-129269406 GAAGGGGAAGGGAAAGGAGAAGG - Intronic
1104899292 12:132179728-132179750 CTCAGGAAAGGGTAGGGAGAAGG + Intergenic
1105250996 13:18698223-18698245 CTCTGGGGGCGGAAAGCAGAGGG + Intergenic
1106014634 13:25857118-25857140 CTGGGAGAAGGAAAAGGAGAAGG - Intronic
1106114831 13:26808405-26808427 CTCTGAGGGTGGAAAGGAGATGG - Intergenic
1106317182 13:28604940-28604962 TTCTTGGAGGGGAGAGGAGAGGG + Intergenic
1106422418 13:29595256-29595278 CTCTGGGAAGGGCCAGGACCAGG - Intronic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1108176927 13:47801753-47801775 CTATGAGAAGGCAATGGAGAGGG - Intergenic
1108526936 13:51293471-51293493 CTGTGGGCAAAGAAAGGAGAAGG - Intergenic
1108851395 13:54736095-54736117 GTGAGGGAAGGGAAGGGAGAGGG - Intergenic
1109618652 13:64871703-64871725 CTCTGGGATATAAAAGGAGAAGG + Intergenic
1110175840 13:72554367-72554389 GGCTGGGAAGGGCAAGGAGTGGG + Intergenic
1110674537 13:78225145-78225167 ATCTGGGAACGGAAAGGAGAAGG + Intergenic
1110916746 13:81030608-81030630 CTCTGCCTGGGGAAAGGAGATGG - Intergenic
1111661487 13:91217804-91217826 CTCTGTTAGGGGAAAGGAGTTGG - Intergenic
1111832810 13:93351424-93351446 GTCTGGGAAGGGTAGGGGGAAGG + Intronic
1112111788 13:96308587-96308609 CTCTGGAAAGGTAGAGGTGAAGG + Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112419470 13:99234652-99234674 CTATGAGAAGGGAAAGGACCTGG - Intronic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1112762114 13:102703222-102703244 AGCAGGGAGGGGAAAGGAGAAGG - Intergenic
1113286236 13:108852015-108852037 CTCTGGGAGAGGGAAGGACATGG - Intronic
1113445547 13:110363614-110363636 CCTTGGGGAAGGAAAGGAGAGGG + Intronic
1113541760 13:111115118-111115140 GGCGGGGAAGGGAAAGGGGAAGG - Intronic
1113564191 13:111308752-111308774 GTCTGGGCAGCCAAAGGAGAAGG + Intergenic
1114332564 14:21652140-21652162 CTGGGAGAGGGGAAAGGAGAGGG + Intergenic
1114906412 14:27133279-27133301 GTCAGGGGAGGGTAAGGAGAAGG - Intergenic
1115947527 14:38678969-38678991 CACTGGGAAGGGTAGGGGGAGGG - Intergenic
1116135556 14:40918760-40918782 CTCTGGGAGGGTAAAGAAGAGGG - Intergenic
1116257724 14:42578366-42578388 GTCTGGGAAGGGTACTGAGAGGG + Intergenic
1116484002 14:45424953-45424975 CTCTGGGAGGCCAAAGCAGAAGG - Intergenic
1116541915 14:46110075-46110097 TTCTGCTAAAGGAAAGGAGAGGG + Intergenic
1116941779 14:50797997-50798019 CTCAAGGATGGGAAGGGAGAAGG + Intronic
1117061431 14:51967511-51967533 AGCTGGGAAAGGAAATGAGAGGG + Exonic
1117195247 14:53333681-53333703 CTCGGGGCAGGGAAAGTATAAGG - Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118592288 14:67410732-67410754 CTTTGGGAGGGGAATGAAGAGGG - Intronic
1118879950 14:69817453-69817475 TTCTTGGAAGAGAAAGGCGAAGG - Intergenic
1119043426 14:71296190-71296212 GTCTGGGAAGGGCAAAGGGAAGG + Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119671764 14:76525402-76525424 TGCTGGGAAGGAAAAGGAGGGGG + Intergenic
1119720257 14:76885269-76885291 AGCTGGGAATGGGAAGGAGAAGG - Intergenic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119776873 14:77254414-77254436 CTCTGAGAGGGGACAGGAGTAGG + Intronic
1119936773 14:78599183-78599205 CTCTTGGAAGAGGAAGTAGAAGG - Intronic
1120255222 14:82110101-82110123 CTCCAGGAGGGGAAGGGAGAGGG + Intergenic
1120685596 14:87532804-87532826 CTCAGGGTAGGGAAAGAACAAGG + Intergenic
1121322038 14:92997475-92997497 TTCTGGGATGGGAACAGAGAGGG + Intronic
1121798291 14:96753650-96753672 CCCTTGTAAGAGAAAGGAGAGGG - Intergenic
1122227346 14:100287404-100287426 CTCTGGGGTGGGAAAGGGGGAGG - Intergenic
1122261399 14:100525199-100525221 CTCTGGTGAGGGGATGGAGAAGG - Intronic
1122489538 14:102104741-102104763 GGCTGGAAAGGGAAAGGAGAGGG - Intronic
1122557648 14:102590334-102590356 CTGTGGGAGGTGTAAGGAGAGGG + Intergenic
1122956706 14:105074643-105074665 CGCTGTGAAGGGCAATGAGAAGG - Intergenic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1122980302 14:105188945-105188967 GTCGGGAGAGGGAAAGGAGACGG + Intergenic
1122983197 14:105200704-105200726 CTCTGGGGAGGGGATGGAGAAGG - Intergenic
1123466338 15:20518871-20518893 CTCGGGGAAGGAACAGGAGAGGG + Intergenic
1123651776 15:22482167-22482189 CTCGGGGAAGGAACAGGAGAGGG - Intergenic
1123742195 15:23291026-23291048 CTCGGGGAAGGAACAGGAGAGGG - Intergenic
1123761129 15:23433459-23433481 CTCGGGGAAGGAACAGGAGAGGG + Intergenic
1124059036 15:26270986-26271008 CACTGGGAAAGAAAAGGAAAAGG - Intergenic
1124277065 15:28334849-28334871 CTCGGGGAAGGAACAGGAGAGGG + Intergenic
1124305635 15:28576757-28576779 CTCGGGGAAGGAACAGGAGAGGG - Intergenic
1124322014 15:28721147-28721169 CTCAGGCAAGGGAAAGGCGTGGG - Intronic
1124523114 15:30422989-30423011 CTCAGGCAAGGGAAAGGCGTGGG - Intergenic
1124535552 15:30543227-30543249 CTCAGGCAAGGGAAAGGCGTGGG + Intergenic
1124624171 15:31298836-31298858 CTGTGGGATGGGCAAGGAGTGGG - Intergenic
1124763102 15:32464369-32464391 CTCAGGCAAGGGAAAGGCGTGGG - Intergenic
1124775524 15:32584690-32584712 CTCAGGCAAGGGAAAGGCGTGGG + Intergenic
1125396021 15:39248817-39248839 CTTTGGGAAGAGAAAGGTGAAGG + Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125582578 15:40797124-40797146 CTTTGGGAAGCCAAAGCAGAAGG + Intronic
1125601046 15:40915919-40915941 CTCAGCGAAGGGACAGGAGGAGG + Intergenic
1125607438 15:40949137-40949159 CTCTGGTAAGAGAAGAGAGAAGG + Intergenic
1125685357 15:41560192-41560214 CTCAGGGAAGGGAAGGGAAACGG + Intronic
1126249968 15:46555875-46555897 CCCCAGGAAGGGAAAGGAGAAGG + Intergenic
1126457923 15:48884816-48884838 CTCTGGGAAGGGAAAGATGAGGG - Intronic
1126739149 15:51760325-51760347 GGCTGGGAAGGGCAAGGACATGG - Intronic
1126741900 15:51785665-51785687 GCCTGGGAAGGGAAGGGAGTAGG + Intronic
1126815532 15:52449754-52449776 CTTTGGGAAGCCAAAGGAGGAGG + Intronic
1126864139 15:52919355-52919377 GGCTGGGAAGGGTAGGGAGAAGG + Intergenic
1127155692 15:56122767-56122789 CTCTGACTAGGGAAAGGGGAAGG - Intronic
1127267507 15:57374041-57374063 CACAGGGAAGGAAAAGGGGAAGG - Intergenic
1127309972 15:57743896-57743918 CTCAGGGAAGAGCAGGGAGAAGG - Intronic
1127410943 15:58706577-58706599 CATAGGGAAGGGAAAGGAAAAGG + Intronic
1127857332 15:62963245-62963267 CTCAGGAAAGGGAAGGTAGAGGG - Intergenic
1128068610 15:64779605-64779627 CTTAGGGTAGGGAAAAGAGATGG + Intergenic
1128109809 15:65069053-65069075 CTGCGGGAAGGGGAAGGAGAAGG - Intronic
1128797647 15:70477311-70477333 CTATGGGGAGGGAATGGGGAGGG - Intergenic
1128934631 15:71734851-71734873 CTCTGGGAAGGGCATGGGGTTGG - Intronic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1128990337 15:72254411-72254433 AACTGGGCAGGCAAAGGAGAGGG + Intronic
1129044252 15:72719488-72719510 CTCTGGGAAGCTAAAGCAGGAGG - Intronic
1129071234 15:72953163-72953185 TTCTGGGTAGGGAAAGGGGTAGG - Intergenic
1129088207 15:73119710-73119732 TTCTGAGTAGGGAAAGCAGATGG - Intronic
1129797017 15:78385426-78385448 CTCTGGGGAGGGAAACCAGGTGG - Intergenic
1130710023 15:86270916-86270938 AGCTGGGAAAGGAAAGGAAATGG - Intronic
1130862054 15:87899874-87899896 CTTTGATAAGGGCAAGGAGAAGG + Intronic
1130919798 15:88334525-88334547 GTCTGGAAGAGGAAAGGAGAAGG + Intergenic
1131007310 15:88988370-88988392 GTGGGGGAAGGGAAAGGAGGGGG - Intergenic
1131253169 15:90844205-90844227 GACTGGGAAGAGAAAGGGGAGGG - Intergenic
1131408564 15:92186696-92186718 CCCTGGCATGGGAAAGGAGAAGG - Intergenic
1131582679 15:93660581-93660603 GTCTGGGAAGGGAAAAGGGAAGG - Intergenic
1131833640 15:96369592-96369614 ATGTGGGGAGGGGAAGGAGAAGG + Intergenic
1132154731 15:99487339-99487361 CTCTAGAATGGGAAAGGAGCAGG - Intergenic
1132387181 15:101408962-101408984 TTCTGGGAAGGAAAAGTAAACGG - Intronic
1132397560 15:101485746-101485768 CTCTGGGAAAGAAGAGGAGGAGG - Intronic
1132482113 16:171961-171983 CTCTGGGTAGGGAAAGGACAGGG - Intergenic
1132827537 16:1912604-1912626 GTCTGGGATGAGAAAGGAGCTGG - Intronic
1132828029 16:1914557-1914579 ATCTGGGAAAGGAAAGGGGTGGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133056411 16:3147589-3147611 CTCTAGGAGAGGACAGGAGAGGG - Intronic
1134547635 16:15122864-15122886 GTAAGGGAAGGGAAAGGAGAAGG + Intronic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135050167 16:19186023-19186045 CTCTTCAAATGGAAAGGAGATGG - Intronic
1135465375 16:22680304-22680326 CTCTGGGATGGGGAAAGAGAAGG + Intergenic
1135752885 16:25070922-25070944 CTCAGGGCAGGGAGAAGAGAGGG - Intergenic
1135851515 16:25968073-25968095 TTCAGGGGAGGGAAGGGAGAGGG + Intronic
1135945196 16:26859069-26859091 GTGAGGGAAGGGAAAAGAGAAGG + Intergenic
1136151963 16:28356791-28356813 GTAAGGGAAGGGAAAGGAGAAGG + Intronic
1136211115 16:28758491-28758513 GTAAGGGAAGGGAAAGGAGAAGG - Intronic
1136255836 16:29038449-29038471 GGAGGGGAAGGGAAAGGAGAAGG - Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136670167 16:31849455-31849477 CTAGGGGAAGGGGAAAGAGAGGG + Intergenic
1137371158 16:47907013-47907035 CTTAGGGAAGGGAGAGCAGATGG + Intergenic
1137868835 16:51929873-51929895 CTTTGGGAAGGGAAGGTTGATGG - Intergenic
1138139147 16:54552167-54552189 CTCTGGGGAGGGAAACAAGATGG - Intergenic
1138599558 16:58046581-58046603 CTTTGGGAAGGAAAAGAGGAAGG - Exonic
1138913514 16:61432541-61432563 CACTGGGAAGAGAAACGAAAAGG - Intergenic
1139216793 16:65133465-65133487 CTCTGGGAAGGGACAAGGGCAGG - Intergenic
1139251710 16:65502778-65502800 CCCTGGGGAGGGACAGGAGATGG - Intergenic
1139326647 16:66157683-66157705 CTCTGGGAAAGGAAAGGAAGGGG - Intergenic
1139588856 16:67921852-67921874 CTCTGGGCAGGGACAGGTGGGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139891031 16:70253468-70253490 CTCTGGGAAGGGGTAGGGGTGGG - Intronic
1139977781 16:70828403-70828425 ATCTGGGAGGGGGAAGAAGAGGG + Exonic
1140182149 16:72730607-72730629 CTATGGGAATGAAAAGGAGGGGG + Intergenic
1140386442 16:74544019-74544041 CTTGGAGAAGTGAAAGGAGATGG + Intronic
1140406490 16:74714537-74714559 CCCAAGGAAGGGGAAGGAGATGG - Intronic
1141110760 16:81269007-81269029 CTTTGGGAGGGGAAGGGAGGAGG - Intronic
1141660428 16:85438354-85438376 CTCTGGGGAGGGACAGGAGGCGG + Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142388819 16:89784706-89784728 CTTGGGGAAGGGGAAGGGGAAGG + Intronic
1142590493 17:1003316-1003338 CTTTGTGAAGAGCAAGGAGAGGG + Exonic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1142774241 17:2123663-2123685 CCCAGGGAAGAGAATGGAGATGG + Intronic
1142824568 17:2500617-2500639 CTATGGGAAGGAAGAGGAGCAGG - Intronic
1142851196 17:2705633-2705655 CTCTGGGAATGAAAGGGGGAGGG - Intronic
1142862471 17:2771224-2771246 CTCTGGCATGGGAAAGGAGGCGG - Intergenic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143334715 17:6163526-6163548 CTTGGTGAAGGGACAGGAGATGG + Intergenic
1143406873 17:6683632-6683654 CTCAGGGGAGGCAAAAGAGAGGG - Intergenic
1143660197 17:8319874-8319896 CTTTGGGAGGTGAAAGGGGACGG - Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1144107409 17:11998096-11998118 GTGTGGGAAAGGGAAGGAGAAGG - Intergenic
1144728305 17:17512655-17512677 CTGTGGGCAGGGGATGGAGAGGG + Intronic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1145032403 17:19514843-19514865 CACTGAGAAGAGAAAGGAGAAGG + Intronic
1145395388 17:22490220-22490242 CTCTGGGAAGGCTAGGCAGAGGG + Intergenic
1146250947 17:31343710-31343732 CTCTGGGAGGCCAAAGCAGAAGG + Intronic
1146265320 17:31449098-31449120 CTTTGGGAATGGGAAGGGGAGGG - Intronic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1146626315 17:34438124-34438146 CCCTGAGAAGGGAAAGGATATGG + Intergenic
1146688521 17:34857312-34857334 ATTTGGGAAGGGAAAGAAGTTGG - Intergenic
1146720388 17:35119689-35119711 CTCTAGGAAGGGGTAGGGGAGGG - Exonic
1146723170 17:35137473-35137495 CATTGGGCAGGGAAAGGGGATGG + Intronic
1146724941 17:35148950-35148972 CTGAGGAAAGGGGAAGGAGAAGG - Intronic
1146733104 17:35212591-35212613 GTCTGGGAAGGGAAAGTATTGGG + Intergenic
1146992062 17:37283404-37283426 ACCTGGGAGGGGGAAGGAGATGG + Exonic
1146992593 17:37288652-37288674 CTCTGGGAGGGCAAGGCAGAAGG + Intronic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1147262064 17:39214503-39214525 CACTGGGACGGGAATGGAGAGGG + Intronic
1147747319 17:42702780-42702802 CTCAGGGAGGGTAATGGAGATGG - Intronic
1147833097 17:43310934-43310956 CTCTGGGAGGAGGAAGCAGAAGG + Intergenic
1147977979 17:44258813-44258835 CCCTGGGTGGGGAAAGGAGAAGG + Intronic
1147978485 17:44261042-44261064 CACTGGGGAGGGAAAGGAGTGGG + Intronic
1148076782 17:44941714-44941736 CCCGGGGAAGGGAAGGCAGAGGG + Intronic
1148094205 17:45041197-45041219 CTCTGTGAAGGGCCAGGAGGAGG - Intronic
1148507697 17:48141154-48141176 AACTGGGAACGGAAAGAAGATGG - Intronic
1148698583 17:49575509-49575531 CTCTTGGAGAGGAAGGGAGAGGG - Intergenic
1148733570 17:49851959-49851981 CTCTGGGAGGGGAAACGAGGTGG - Intergenic
1148757290 17:49980199-49980221 CTCAGGAAGGGGAAAGGAGTCGG + Intergenic
1148808667 17:50277229-50277251 CTAGGGGAAGCGAAAGGGGAGGG + Intronic
1148887816 17:50786445-50786467 CACTGGAAAGGGAAAGAACAGGG + Intergenic
1148977727 17:51544405-51544427 GTCTGGGAGGGAAAAAGAGAAGG - Intergenic
1149131062 17:53302977-53302999 CTCTGGGAAAGGCCAGCAGACGG - Intergenic
1149587797 17:57804452-57804474 CTTTGGGAAGGTAAGGCAGAAGG - Intergenic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150209854 17:63435963-63435985 CTCTGGGGAGGGAACAGAGCAGG + Intronic
1150438882 17:65175727-65175749 CACAGGGAAGAGAAAGGAAAAGG - Intronic
1150441114 17:65192272-65192294 GACTGGGAAGGGAAGGGGGAAGG + Intronic
1150470062 17:65429694-65429716 CTCCATGAAGAGAAAGGAGAGGG + Intergenic
1150804830 17:68310509-68310531 ATCTAAGAAGGGAAAGGAGCTGG - Intronic
1151343494 17:73486892-73486914 CTGTGGGAAGGCACAGGTGAGGG + Intronic
1151391610 17:73791065-73791087 CACTGGGAAGGGACACAAGAAGG + Intergenic
1151462480 17:74262781-74262803 CTCCCGCAAGGGAAAGGAGTGGG + Intergenic
1151728005 17:75895534-75895556 CTCTGGGATGGGAAAGAACTGGG - Intronic
1151767088 17:76138220-76138242 CTCTGGCAGGGGAGAGGAGGGGG + Intronic
1152107235 17:78337769-78337791 GAGTGAGAAGGGAAAGGAGAAGG - Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152378962 17:79932382-79932404 CTTTGGGAGGGTAAAGGACAGGG - Exonic
1152519514 17:80846986-80847008 CTCTTGGGAAGGACAGGAGATGG + Intronic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1152939719 17:83161787-83161809 CAATGAGAAGGGAAGGGAGATGG - Intergenic
1152975494 18:213494-213516 CTTTGAGAAGGGAGAGGAGTAGG + Exonic
1153119164 18:1700422-1700444 CTCTGGAAAGAGGAAGGAGCAGG + Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153300078 18:3584626-3584648 CTCTGGGATGGGGAAAGACAAGG + Intronic
1153803156 18:8689207-8689229 TTTGGGGAAGGGGAAGGAGAGGG + Intergenic
1154505049 18:15029142-15029164 CTCAAGGAGGTGAAAGGAGATGG + Intergenic
1155170459 18:23263315-23263337 GGCTGGGAAGGGCAGGGAGAAGG - Intronic
1155263477 18:24068022-24068044 CTCTCTGAAGGGTAAGGACAGGG - Intronic
1155371280 18:25103734-25103756 CTCTGTGATGGGAAGAGAGAAGG + Intronic
1155680850 18:28483691-28483713 CTCTGAGCAGGGAAAGAAGTGGG + Intergenic
1155746436 18:29361291-29361313 CTAAGGGAAGGGGAAGGAGAGGG - Intergenic
1156013218 18:32517759-32517781 CTGGGAGAGGGGAAAGGAGAAGG - Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157083604 18:44554608-44554630 TTCTGGGAATGGCAAGCAGAAGG - Intergenic
1157282237 18:46353749-46353771 ATCTGAGAAGGGAAAGGAAACGG + Intronic
1157712301 18:49858425-49858447 CTCTGGTGTGGGAAAGGAGGTGG - Intronic
1157739918 18:50083341-50083363 CTCTGGGAGAGGAAAGGGGCTGG - Intronic
1157867925 18:51202255-51202277 CTCAAGGAAGGGAAAGGAAGAGG - Intronic
1158915330 18:62120202-62120224 CTGGGGGAAGGGGAAGGGGAAGG + Intronic
1158941128 18:62406567-62406589 CTGGGGGATGGGAAAGGACATGG - Intergenic
1158952983 18:62513242-62513264 CTTTGGGAAGCCAAAGGAGGAGG - Intergenic
1159022616 18:63155809-63155831 CTCTGGAGAAAGAAAGGAGAGGG - Intronic
1159858539 18:73618188-73618210 CTCTGGGTAGTGACATGAGATGG - Intergenic
1159995578 18:74960910-74960932 CTGGGTGAAGGGATAGGAGAAGG + Intronic
1160230828 18:77047478-77047500 GTCGGGGAAGAGAATGGAGAAGG + Intronic
1161131620 19:2592986-2593008 CGGAGGGAGGGGAAAGGAGAAGG + Intronic
1161431455 19:4234742-4234764 CTCTGGGAAGGGCCAGGACCCGG - Exonic
1161443164 19:4304053-4304075 TTCTGGGGAGGGGAAGGAGTGGG - Intergenic
1161857282 19:6773100-6773122 CTCTGGGCCTGCAAAGGAGAGGG + Intronic
1161936768 19:7376887-7376909 CCCAGGGAAGGGAAGGGAGCTGG + Intronic
1161941202 19:7405389-7405411 GTCTGTGTAGAGAAAGGAGAGGG - Intronic
1161973707 19:7597163-7597185 ATCTGGGAAGGCCAGGGAGAGGG - Intronic
1162095879 19:8309707-8309729 CTCTGGAAGGGGAAAGGCCACGG - Intronic
1162101081 19:8339277-8339299 CTCTGGGAAGCCAAAGCAGAAGG + Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162433296 19:10642320-10642342 CTCTGGGAAGGACACGGAGCAGG + Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1163166187 19:15499719-15499741 CCCTAGGAAGGGAAAGGATTGGG - Intergenic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1163386700 19:17004463-17004485 CTCAGGGAAGGAGAAGGAGCAGG - Intronic
1163418854 19:17203105-17203127 CGCTGGGCAGGGAAAGGGGAAGG - Intronic
1163504890 19:17699768-17699790 CTCAGGGCAGGGGATGGAGAAGG + Intergenic
1163661573 19:18581079-18581101 CTTTGGTAAGGGAAAGGGGTGGG - Intronic
1163754805 19:19100429-19100451 CCCAGAGAAGAGAAAGGAGATGG - Intronic
1163787210 19:19280974-19280996 CTCTGGGAAGGGAAAAGATTTGG + Intronic
1163801126 19:19366333-19366355 GGCTGGGAAAGGAAAGGAAAAGG + Intergenic
1163976622 19:20858846-20858868 CTAGGGGAAAGGGAAGGAGAGGG + Intronic
1164465397 19:28483339-28483361 CAGAGGGAAGAGAAAGGAGAAGG - Intergenic
1164533869 19:29069584-29069606 TTCTGGCAGGGGAAAGGAAAAGG + Intergenic
1164540548 19:29118597-29118619 CTCCTGGAAGTGAAAGGAGGTGG + Intergenic
1164613336 19:29648526-29648548 CTTTGGGAAGGTTTAGGAGAGGG + Intergenic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1165085602 19:33344389-33344411 ATCCGGGAAGAGAGAGGAGAAGG - Intergenic
1165354490 19:35295365-35295387 CGCTGGAAAGGGAGAGGAGAGGG - Exonic
1165696405 19:37904300-37904322 TTCTGGGAAGGGGAAACAGAAGG - Intronic
1165828479 19:38718996-38719018 CTCTGGGAAGGGATGGGAGGTGG - Intronic
1165829434 19:38723237-38723259 CTCTGGGGAGGAACAGGACATGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166689511 19:44814129-44814151 CTAAGGGAAGGGCAGGGAGATGG - Intronic
1166814197 19:45532518-45532540 GACTGGGAAGGGGTAGGAGAAGG - Intronic
1166863685 19:45823708-45823730 CCCGGGGAAGGCTAAGGAGAGGG + Intronic
1166938651 19:46350060-46350082 TTCTGAGTAGGGAAAGGACAGGG + Intronic
1167105331 19:47427147-47427169 CTTTGGGAAGCCAAAGCAGAAGG - Intergenic
1167120383 19:47513152-47513174 CTCTGGGCAGAGGAAGGAGAAGG - Intronic
1167120398 19:47513267-47513289 GTCTGGGAGGGGTCAGGAGAGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167384049 19:49153773-49153795 TTCTGAGGAGGAAAAGGAGAAGG - Exonic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167631561 19:50629256-50629278 CCCTGGGAAGGGGAAGGTCAGGG + Intronic
1168623336 19:57896458-57896480 TTATGGGGAGGGAAAGGAGGTGG - Intronic
925140108 2:1544264-1544286 CTCTGGGCAGTGAAGGGAGGTGG + Intergenic
925422601 2:3724977-3724999 GTCTGGGTTGGGAAGGGAGAGGG + Intronic
925898521 2:8491964-8491986 ACATGGGAAGAGAAAGGAGAGGG - Intergenic
927387346 2:22550221-22550243 TTGTGGAAAGGAAAAGGAGAGGG + Intergenic
927521835 2:23703648-23703670 TTCTGGGAAAGAAAAGGAGAGGG + Intronic
927894010 2:26769794-26769816 CTCAGTGAAGGGAAAGGAGAAGG + Intronic
927916662 2:26941494-26941516 CTCATGGAAGGCCAAGGAGATGG + Intronic
927945028 2:27130522-27130544 GTATGGGAAGGGCTAGGAGAGGG - Exonic
928998367 2:37321467-37321489 ATGGGGGAAGGGGAAGGAGAGGG - Intronic
929087062 2:38178824-38178846 CTTTGGGAAGGACAAGGGGATGG - Intergenic
929123165 2:38500053-38500075 ATTTGGAAAGGAAAAGGAGATGG - Intergenic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929372262 2:41240616-41240638 CTTTGGGAAGGCAAAGCAGATGG - Intergenic
929481211 2:42310276-42310298 GAATGGGAAGGGAAAGGGGAAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
930788055 2:55291853-55291875 CACTGAGTAGGGCAAGGAGAAGG + Intronic
930873421 2:56189228-56189250 CCCTGGCAAAGGAAAGGTGATGG + Intronic
930964386 2:57303547-57303569 TGCTGGGAAGGGGAAGGGGAAGG + Intergenic
931625034 2:64249779-64249801 CTCTGGGAAGGGAAGAGGAATGG - Intergenic
931669075 2:64630687-64630709 CACTGGCAAGGGAAAAGGGATGG - Intergenic
931787309 2:65631695-65631717 CTCTAGGTAGGGGAAGGTGATGG - Intergenic
932262942 2:70342265-70342287 CATAGGCAAGGGAAAGGAGATGG + Intergenic
933061227 2:77739414-77739436 ATCTTTGAAGAGAAAGGAGAAGG + Intergenic
933852991 2:86385752-86385774 ATGTGGGGAGGGAAAGGAGGAGG + Intergenic
933940475 2:87240711-87240733 TTCTGGGTAGGGAAAGCAGCTGG - Intergenic
935184419 2:100718588-100718610 CCTTGGGGAGGGAAAGGAGCAGG + Intergenic
935225309 2:101047401-101047423 ATCTGGGAAGGGAAGGGAAAAGG + Intronic
935735841 2:106106032-106106054 CTCTGAGAAGGAAAAGGGGAAGG + Intronic
936352662 2:111725065-111725087 TTCTGGGTAGGGAAAGCAGCTGG + Intergenic
936859148 2:116995019-116995041 CAATGGGAAGGGGAAGAAGAGGG + Intergenic
936947139 2:117941135-117941157 GGCTGGGAAGGGACAGGCGAGGG - Intronic
937057494 2:118952029-118952051 CTAGGGGAAGGGGAAGGAGAAGG - Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937646775 2:124274505-124274527 CGCTGGCCAGGGAATGGAGAAGG + Intronic
937905337 2:127050228-127050250 CCAAGGGAAGGGAGAGGAGAGGG + Intronic
938225878 2:129615796-129615818 GTCTGGGGAGGGGAGGGAGAAGG + Intergenic
938244827 2:129768374-129768396 CTCAGGGAAAGGCAAGTAGAGGG - Intergenic
938302041 2:130222755-130222777 CTGTGGGAAGGGAAATGAAATGG + Intergenic
938454659 2:131451697-131451719 CTGTGGGAAGGGAAATGAAATGG - Intergenic
938504247 2:131859408-131859430 CTCAAGGAGGTGAAAGGAGATGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
938750222 2:134321117-134321139 CTCTGGAGAAGGAAATGAGAAGG - Intronic
938881739 2:135596532-135596554 CTCTGGAGAGGGAAATGAAAGGG - Intronic
938894889 2:135740192-135740214 CTCTAGGTAGGTGAAGGAGAAGG - Intergenic
939285320 2:140121835-140121857 CACTGGGAAGGGGATGGAGCGGG - Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939501839 2:142996530-142996552 GTCTGGGCAGTGAAAGAAGAGGG + Intronic
939625562 2:144473115-144473137 CTATGAGAATGGAAAGGAAAGGG + Intronic
939628471 2:144507742-144507764 ATCTGAAAAGAGAAAGGAGAAGG - Intronic
940897805 2:159097292-159097314 CTCAGAAAAGGAAAAGGAGAGGG - Intronic
941160109 2:162026131-162026153 GTCTGCGAAGGGAGTGGAGATGG - Intronic
941360087 2:164540672-164540694 CTCTGGGGAGGGAAAGCAGGAGG - Intronic
941993042 2:171575722-171575744 CTCTGGGGAGGGAAGAGAGAAGG + Intergenic
942086499 2:172449064-172449086 GCCTGGGAAGTGAAAGGAGGAGG + Intronic
942209469 2:173655879-173655901 CTCTGGGAAAGGAAACTGGATGG - Intergenic
942246536 2:174013337-174013359 CTCTGGGGAAGGGGAGGAGAGGG - Intergenic
942300559 2:174557242-174557264 CTGGGGGAAGACAAAGGAGAAGG + Intergenic
942520029 2:176793919-176793941 CTCTGGGTAGGGAATAAAGAGGG - Intergenic
943177348 2:184493607-184493629 GGCTGGGAAGGGTAGGGAGAAGG - Intergenic
943700700 2:190985984-190986006 CTCTGCTGAGGGAAAGGGGAGGG - Intronic
943751746 2:191516373-191516395 AGCGGGGAAGGGAAAGGAGAGGG + Intergenic
944526435 2:200624473-200624495 GTTTGGAAAGGGAAAGGGGAGGG + Intronic
944572432 2:201058205-201058227 CTGTGTGAAGAGGAAGGAGAGGG - Intronic
944572589 2:201059569-201059591 CTCTGTGAGGGGAAAGGAAAGGG - Intronic
944954773 2:204796193-204796215 CCCTGGTAGAGGAAAGGAGAGGG - Intronic
945035355 2:205699668-205699690 CTCTGACAAGGGGAAGAAGAAGG + Intronic
945042193 2:205751791-205751813 CCCTGGGAAGGGAAGTGAGAAGG + Intronic
945532000 2:210967271-210967293 CCCTGGTAAGGAAAAAGAGAAGG + Intergenic
945679582 2:212897887-212897909 CTCTGGGGAAGGATAGGAGGAGG + Intergenic
946111405 2:217421057-217421079 CTCTGGGAAAGGCAAGCTGAGGG + Intronic
946293357 2:218763074-218763096 CTGGGGGAAGGGATAGGACAAGG + Intergenic
946353078 2:219168361-219168383 CTGAGGGATGGGAAAGGAGGTGG + Intronic
946414155 2:219531103-219531125 CTTTGGGAAGCCAAAGCAGAAGG + Intronic
946444595 2:219727402-219727424 CTTAGGGTAGGGAAATGAGAAGG + Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946932331 2:224682876-224682898 CTCTGGGACGAGATATGAGAAGG + Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947407826 2:229799242-229799264 CTATGGGGAGGTAAAGGGGAGGG - Intronic
947740159 2:232481252-232481274 CTCTGGGCAAGGGAAGGAGAGGG - Intronic
948107328 2:235425824-235425846 CTTTGGGAAGGCAAAGCAGGTGG - Intergenic
948159299 2:235811216-235811238 CTCTGCGAAGGGCACGGAGGAGG - Intronic
948658814 2:239493992-239494014 TGCTGAGAACGGAAAGGAGAAGG - Intergenic
948680904 2:239634079-239634101 CACTGGGGAGGCAAGGGAGATGG + Intergenic
948680925 2:239634139-239634161 CACTGGGGAGGCAAGGGAGATGG + Intergenic
948855248 2:240727305-240727327 CACAGGGAAGGGAGAGGGGAGGG + Intronic
1168760467 20:346990-347012 CTCTGGAAGGGGACAGGAGCCGG + Intronic
1168901305 20:1367444-1367466 CGCTGGAAAGGGCAAGGAAACGG - Intronic
1169997097 20:11570842-11570864 CTCTGGAAAAGGCAAGGAAAGGG - Intergenic
1170015654 20:11778901-11778923 CTCTGGCATGGGAGAGGAAATGG + Intergenic
1170509390 20:17060860-17060882 CCCTGGGAAGGGAACTGGGAAGG + Intergenic
1170562959 20:17572921-17572943 CTCTAGGGAGGGAAGGGAGTGGG - Intronic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1170810605 20:19671232-19671254 CTCTGGGAGAGGGAAAGAGACGG + Intronic
1171303445 20:24084276-24084298 CACTGGGTAGGGAAAGCAGCTGG - Intergenic
1172013592 20:31860729-31860751 CACAGGGAAGGGAAGGGAGTCGG + Intronic
1172432607 20:34905159-34905181 CTCTGGGAGGGCAAAGCAGGAGG - Intronic
1172526840 20:35604939-35604961 CTTTGGGAAGCTAAAGCAGAAGG - Intergenic
1172773489 20:37394688-37394710 CTCAGGGGAGGGACAGGAGAGGG - Intronic
1172912896 20:38423151-38423173 CTTTTGGAAGCGAAAGCAGAAGG + Intergenic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1172976925 20:38913112-38913134 CTCTGGGAAGCGAAGGCAGGTGG - Intronic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173328844 20:42057473-42057495 CTCTCAGAAGGAAAAGAAGATGG - Intergenic
1173465445 20:43277391-43277413 CCTTGGGAAGGGGAAAGAGAAGG - Intergenic
1173507432 20:43599030-43599052 CGCTGGGAATGGCATGGAGAGGG + Intronic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173633720 20:44536445-44536467 CAGCGGAAAGGGAAAGGAGAGGG + Intronic
1173808190 20:45939702-45939724 CTCTGGGGAAGGCAAGGAGATGG + Intronic
1173809006 20:45945026-45945048 CTCAGGTAGGGGAAAGGTGAAGG + Exonic
1173934837 20:46852194-46852216 CTCTGGGCTGGGAGAGGACATGG + Intergenic
1174019713 20:47520395-47520417 CTAGGGGAAGGGCAAGGAGAGGG - Intronic
1174400272 20:50272221-50272243 GTCTGGGCAGGGAATGGGGAGGG + Intergenic
1174708816 20:52684224-52684246 CTCTGGGAACGCAGAGGGGATGG - Intergenic
1175117256 20:56691370-56691392 CTGGGGGCAGGGAAAGGAGCTGG - Intergenic
1175359110 20:58393546-58393568 CTCATGGAAGGGGAGGGAGAAGG - Intronic
1175385445 20:58592014-58592036 AGCTGGGAACGGCAAGGAGATGG + Intergenic
1175707623 20:61192763-61192785 CTAGGGGAAGGGGAAGGGGAAGG - Intergenic
1175782436 20:61691038-61691060 CTCTCAGAAGGAAAAGGAAAAGG - Intronic
1175892148 20:62320670-62320692 CTGTGGGAGGCGAAAGGTGAAGG + Intronic
1176224735 20:63990327-63990349 CTCTGGGAGGCCAAAGGATATGG - Intronic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176792803 21:13339938-13339960 CTCAAGGAGGTGAAAGGAGATGG - Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176890925 21:14318327-14318349 CTCTGGAAAGGTATAGGAAAAGG - Intergenic
1177109982 21:17014521-17014543 CACTGAGAAGGGAAAGGACTCGG + Intergenic
1177740568 21:25148414-25148436 CTCTGCCTATGGAAAGGAGACGG - Intergenic
1178021789 21:28416708-28416730 ATCAGGGAAAGGAAAGAAGAGGG - Intergenic
1178678688 21:34653224-34653246 CCCTGGAAAGGAAAAGGAGGCGG + Intergenic
1178836868 21:36105526-36105548 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
1178932229 21:36829740-36829762 CTCTGGGAAGGGAATAGAGTGGG - Intronic
1179034156 21:37745488-37745510 ATCTGGGAAAGGAAAGGAAGTGG + Intronic
1179250468 21:39667482-39667504 CTCTGGGAATGGTAAGAACAAGG + Exonic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1180154187 21:45970298-45970320 CTCTGCAAAGGGGAAGGTGAGGG + Intergenic
1181674793 22:24444645-24444667 CTTTGGGAAGGGCAGGGAGAGGG - Intergenic
1181815481 22:25433599-25433621 CTGTCGGAAGGGGAAGGGGAAGG + Intergenic
1182148334 22:28011350-28011372 CTTTGGGAAGCCAAAGCAGATGG + Intronic
1182689726 22:32150627-32150649 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689845 22:32151701-32151723 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689973 22:32152776-32152798 TTGAGGGAAGGCAAAGGAGAGGG + Intronic
1182882495 22:33745617-33745639 TTCTAGGAAAGGAAAGGCGAGGG + Intronic
1183034331 22:35129671-35129693 AGCTGGGAAGGGAGAGGAGAAGG + Intergenic
1183153098 22:36053544-36053566 AGATGGGAAGGGAAGGGAGAAGG - Intergenic
1183354381 22:37350576-37350598 CCCGGGGAGGGGAAAGGAGCTGG - Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183543278 22:38442079-38442101 CTCCGGGGAGGGAAAGCAGGTGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183828868 22:40407643-40407665 CTCTTGGCAGGGAAAGGGGTTGG - Intronic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184191598 22:42898679-42898701 CTCGGGGAAGGGCATGGGGAAGG - Intronic
1184313132 22:43661605-43661627 CTGTGAGGAGGGGAAGGAGAAGG - Intronic
1184988384 22:48151584-48151606 AGCTGGGGAGGGAAAGAAGACGG + Intergenic
1185366465 22:50439170-50439192 CCCAGGGCAGGGTAAGGAGAGGG - Intronic
1185417206 22:50716733-50716755 ATCTGGGTCAGGAAAGGAGACGG - Intergenic
949611440 3:5707764-5707786 CAAGGGGAAGGGGAAGGAGAGGG - Intergenic
949683850 3:6546213-6546235 CTTTTGGATGGGAGAGGAGATGG - Intergenic
949865550 3:8544088-8544110 TTCAGGAAAGGGGAAGGAGACGG - Intronic
949927399 3:9052529-9052551 GACTGGGAGGAGAAAGGAGACGG - Intronic
950193320 3:10992714-10992736 CGCGGGGAAGGGAGAGGAGGGGG - Exonic
950266143 3:11574481-11574503 GGCTGGGAAGGGTAGGGAGAAGG + Intronic
950357670 3:12425499-12425521 CTCTGGGCAGGATAAGGGGAGGG - Intronic
950738150 3:15027839-15027861 CTTTGGGAGGGCAAAGCAGAAGG - Intronic
950753708 3:15154443-15154465 CTGTGGCAAGGGAAAGGAAATGG - Intergenic
951589797 3:24251685-24251707 TTCAGGGAAGGGAGAGGAGGGGG - Intronic
951838042 3:27003806-27003828 CTTTTGGTAGGGAAAGGAGGTGG - Intergenic
952102585 3:30032056-30032078 GGCTGGAAAGGGAAGGGAGAAGG - Intergenic
952429894 3:33213162-33213184 CTCTGGGAAGCCAAAGCAGGAGG + Intronic
952883536 3:37999424-37999446 CTCTGGGAAGGTGGAGGTGAGGG + Exonic
953323617 3:41993884-41993906 ATCTGGGAAGTCATAGGAGAAGG - Intergenic
953604356 3:44401144-44401166 CTCTGGTGGGGGAGAGGAGAGGG + Intronic
954164902 3:48748927-48748949 CTCCAGGAAGCGAAAGCAGAAGG - Exonic
954423882 3:50433160-50433182 GCCTGGGAAGGGAAGGGATAGGG - Intronic
954441587 3:50525173-50525195 CACTGGTGAGGGGAAGGAGAGGG + Intergenic
954482971 3:50818661-50818683 CACTGGGACAGGAAGGGAGAGGG + Intronic
954604492 3:51898102-51898124 CTAGGGGAAGGGGAAGGAGAGGG + Intronic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954622236 3:52002849-52002871 TGCTGGGGAGGGAAAGGAGAGGG - Intergenic
954677367 3:52323318-52323340 CTGGGGGCAGGGAAAAGAGAGGG + Intronic
954690745 3:52394444-52394466 CTCTGGCAGGGGACAGGAGGAGG - Exonic
954747782 3:52796760-52796782 CCCTGGGAATGTCAAGGAGAAGG + Exonic
955954410 3:64274018-64274040 GGCTAGGAAGGAAAAGGAGAAGG + Intronic
956145224 3:66185112-66185134 GTCTGGGAAAGGAAAAAAGAGGG - Intronic
956272423 3:67462206-67462228 CTGTGGGAAGAAAAAGGAGCAGG - Intronic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
957314627 3:78561627-78561649 GGCTGGGAAGGGAAAAGGGAGGG - Intergenic
957330332 3:78755146-78755168 CTCTGTGAATGAAATGGAGAGGG + Intronic
957810455 3:85215001-85215023 TTCTGCTTAGGGAAAGGAGAAGG - Intronic
958619269 3:96534789-96534811 GGGAGGGAAGGGAAAGGAGAAGG + Intergenic
959255166 3:104001225-104001247 TTATGGGAAGGGAAAGTAAAGGG + Intergenic
959388974 3:105749373-105749395 CACTGGGATGGGAAAAGAAAGGG - Intronic
959425862 3:106187652-106187674 TTCTGGTCAGGGGAAGGAGAAGG - Intergenic
959492793 3:107011711-107011733 GGCTGGGAAGGGTAAGGAGGAGG + Intergenic
959521416 3:107326699-107326721 CTCGGGGAAGGGGCAGGAAAAGG + Intergenic
959534228 3:107467543-107467565 CTCTGGGAAGCCAAGGCAGAAGG + Intergenic
960944771 3:122958443-122958465 CCCTGGGCAGGGGCAGGAGAGGG - Intronic
961106318 3:124245138-124245160 CGCTGGGAAGAGAAGGGAGAAGG - Intronic
961161518 3:124730634-124730656 GCCTAGGAAGGGAAAGGACAGGG + Intronic
961202270 3:125054965-125054987 CATTGGGAAAGGAAAGGGGAGGG + Intronic
961769334 3:129237169-129237191 CTTTGGGAGGCGAAAGCAGACGG + Intergenic
961837211 3:129672352-129672374 CTTTGGGAGGTCAAAGGAGAAGG + Intronic
961951110 3:130750065-130750087 CACTGTGAAGGAAAAGTAGAAGG - Intergenic
961999065 3:131276035-131276057 CTCTGTGAAGGCCAAGGTGAAGG - Intronic
962302186 3:134252231-134252253 CTCAGGGAAGGGTAGGGAAAAGG + Intergenic
962809155 3:138946885-138946907 CTAGGGGAAGGGGAAGGAGAGGG - Exonic
963398594 3:144766705-144766727 GTTTGGGAAGGGAAAGGAGAGGG + Intergenic
963755482 3:149231298-149231320 ATCTGAAAAGGGAAAGGAAAGGG + Intergenic
963846632 3:150165511-150165533 CTTTGGGAAGCTGAAGGAGAAGG - Intergenic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
963947547 3:151162680-151162702 CTCTGGGAAGCCAAGGCAGAAGG - Intronic
963986025 3:151595779-151595801 CTAGGGGAAGGAGAAGGAGAAGG + Intergenic
964271358 3:154959704-154959726 CTATGGGATGGGATGGGAGAAGG + Intergenic
964653315 3:159036822-159036844 CTCTGGGAAAGGAAAATATAAGG - Intronic
965570593 3:170168147-170168169 CTCTGTCAAAGGAAAGGAAAGGG + Intronic
966294374 3:178401969-178401991 CTATGGGAAGGAGAAGGAGAAGG - Intergenic
966486784 3:180479871-180479893 CTCTGGGAAGTGGCAGCAGATGG - Intergenic
966764146 3:183444492-183444514 CTCTGGGAAGGAAAATGTGGTGG - Intergenic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
967675280 3:192291335-192291357 CTTTGGGAGGGCAAGGGAGAAGG + Intronic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
968609989 4:1552563-1552585 CTCAGGGAGGAGAGAGGAGAGGG - Intergenic
968614942 4:1573537-1573559 ATCTGGGAAGAGGAAGGAGTTGG - Intergenic
968841964 4:3014167-3014189 CTGTGATAAGGGAAAGGAAAGGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969842575 4:9893284-9893306 CTCTGGGAAAGCAAAGATGAAGG - Intronic
970172067 4:13300238-13300260 CTTTGGGATAGGAAATGAGATGG - Intergenic
970268956 4:14322128-14322150 GTCTGGAAAGGGGAAAGAGAAGG - Intergenic
970806206 4:20037002-20037024 GCCTGGGACTGGAAAGGAGAGGG - Intergenic
971243477 4:24909218-24909240 CTCTGGGCAGGTGATGGAGAGGG + Intronic
971386112 4:26141800-26141822 GGCTGGGAAGGGAAAGGGGGAGG - Intergenic
972140282 4:35950776-35950798 ATGTTGGAAGGCAAAGGAGAAGG + Intronic
972288828 4:37672167-37672189 CTCTGGGAAGGGAAAGGGGCTGG - Intronic
972545442 4:40076067-40076089 CTTTGGGAAGCCAAAGGAGGAGG - Intronic
972607584 4:40628543-40628565 CTCAGGGGAGGGAAAGCAAAGGG - Intronic
972739023 4:41873634-41873656 GGCTGGGAAGGGAGAGGGGAGGG - Intergenic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
972784753 4:42315799-42315821 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
972909273 4:43794627-43794649 CTCTGGGAACAGAGAAGAGAGGG - Intergenic
972953067 4:44353615-44353637 GGCTGGGAAGGGTAATGAGAAGG - Intronic
973153111 4:46912666-46912688 ACCTGGGAAGGGGCAGGAGATGG - Intergenic
973637547 4:52874177-52874199 TTCTAGGAAGGAAAAGTAGAAGG + Intronic
973695435 4:53486136-53486158 CTCTTGGGAGGGAAAGAATATGG - Intronic
973979570 4:56296669-56296691 TTCTGGGGAGGGGAAGGAGGAGG + Intronic
974015054 4:56641781-56641803 CTTGGTGAAGGTAAAGGAGAGGG + Intergenic
974077568 4:57181485-57181507 CTCTGGAAAGGGACTGGAAAAGG - Intergenic
974201340 4:58645324-58645346 CTTTGGGAAACAAAAGGAGAAGG + Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
974915138 4:68170308-68170330 GTCTGGGAAGGGTAAAGGGAAGG - Intergenic
975549041 4:75591350-75591372 CTTTGGGAAGCTAAAGCAGAAGG + Intronic
975818188 4:78241431-78241453 ATCTCATAAGGGAAAGGAGAGGG + Intronic
975856235 4:78627485-78627507 CTCTGGGATGGGGATGGGGAAGG + Intergenic
976120569 4:81776235-81776257 GTCTGGGAAGGGTAGGGAGAGGG + Intronic
976155718 4:82142650-82142672 TTCTGGGAATGGAAAGAATAAGG + Intergenic
976202962 4:82598012-82598034 CTGTGGGAAGGCAAAGTCGAAGG - Intergenic
976490081 4:85660469-85660491 CTCAGGGAAGGGAGAGGAATTGG + Intronic
976815339 4:89140929-89140951 CTCAGAAAATGGAAAGGAGATGG - Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977472276 4:97455879-97455901 CTCTGGGAGGAGAATGTAGATGG - Intronic
977983345 4:103352581-103352603 GGCTGGGAAGGGAAAGCAGAGGG - Intergenic
978482503 4:109210133-109210155 ATTTGGGAAGGGAAAAGGGAGGG + Intronic
978603701 4:110455805-110455827 GTCTGGGATAGGACAGGAGAGGG + Intronic
979209891 4:118087417-118087439 TGATGGGAAGGGAAAGGATATGG - Intronic
979922128 4:126511473-126511495 GTCTGGGAAGGGGAAAGGGAGGG - Intergenic
980065035 4:128178148-128178170 CTCTGAGAAGGGAAAGCAGGAGG + Intronic
980169462 4:129271337-129271359 GACTGGGAAGGGTAGGGAGAAGG - Intergenic
980439087 4:132817668-132817690 TCTAGGGAAGGGAAAGGAGAGGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
980785245 4:137545300-137545322 CTCTGGGGATGGAAAGGGAAGGG - Intergenic
981400099 4:144303639-144303661 CTATGGTAACTGAAAGGAGATGG + Intergenic
981506885 4:145511508-145511530 CTCTGGGAAGCCAAGGTAGAAGG - Intronic
982314529 4:154018779-154018801 CTCAGGGGAGGGAAAGGGGAGGG + Intergenic
982559290 4:156909893-156909915 CCCTTGTAAGAGAAAGGAGAGGG + Intronic
982699354 4:158642444-158642466 GGCTGGGGAGGGTAAGGAGAAGG - Intronic
983009983 4:162536137-162536159 GTGTTGGAAGAGAAAGGAGAGGG + Intergenic
983517364 4:168672400-168672422 GGCTGGAAAGGGGAAGGAGAAGG - Intronic
983634034 4:169880049-169880071 CACTGGCCAGGGAATGGAGAAGG - Intergenic
984797648 4:183678702-183678724 CTCTAGAAAGGGAAATTAGATGG + Intronic
984911225 4:184676357-184676379 GGAAGGGAAGGGAAAGGAGAAGG - Intronic
985512576 5:320961-320983 CACCGGGAGGGGGAAGGAGAAGG + Intronic
985573960 5:665194-665216 CTCTGGCAAGGGCAAGGGCAAGG - Exonic
985754375 5:1704443-1704465 TGCTGGGAAGAGAACGGAGAAGG - Intergenic
985796005 5:1962552-1962574 CACTGGAAAGGAAAAGGCGAGGG - Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985857812 5:2443924-2443946 TGCTGGGAAGAGAAAGGAAAAGG - Intergenic
986041903 5:4001706-4001728 GTCTTGGAAGGGAATGGAGCTGG - Intergenic
986183914 5:5418822-5418844 CTCTGAGGAGGGATAGGAAAGGG - Intergenic
986206396 5:5628804-5628826 CTGAGGGAAGGACAAGGAGATGG - Intergenic
986211994 5:5682659-5682681 CACTAGGAAGGGGAAGGTGAAGG + Intergenic
986764347 5:10911336-10911358 CTCTCTGAAGGGGAAGCAGAGGG + Intergenic
987201981 5:15586401-15586423 CTTTGGGAAAGAAAAGGAGGGGG - Intronic
987255737 5:16149129-16149151 CACTGGGCAAGGAAATGAGAAGG - Intronic
987516583 5:18918115-18918137 ATGGGGGAAGGCAAAGGAGAAGG - Intergenic
987938156 5:24496408-24496430 CTCTGAGATGGAAAAGGTGAAGG + Intronic
988453959 5:31371095-31371117 GTATTGGTAGGGAAAGGAGAAGG - Intergenic
988632700 5:32947794-32947816 CTCTGGTAATGGAATGGAGTTGG - Intergenic
988636979 5:32995319-32995341 CTTTGGGAACAGAAAGTAGATGG - Intergenic
988861245 5:35282192-35282214 CTATGGAAAGAGAGAGGAGAGGG + Intergenic
989102521 5:37835741-37835763 CTCTGGGAGGGGAAGGGATTAGG - Exonic
989226256 5:39033075-39033097 CTTTGGGAAGTGAAAATAGATGG - Intronic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
989422065 5:41251895-41251917 CTCTGCTAAGGGAAAAGATATGG + Intronic
990009805 5:50983272-50983294 CTATGGCAAGTGAAGGGAGAAGG - Intergenic
990366140 5:55071670-55071692 ATCTGGAAAGGGCAAGGAAATGG + Intergenic
991395246 5:66198268-66198290 CTCTGCCTGGGGAAAGGAGAGGG - Intergenic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
991562221 5:67965775-67965797 CCCTGGGATGGGAAAGGAATGGG - Intergenic
991610448 5:68444409-68444431 TTCTGGGAAGTGGAAAGAGAGGG + Intergenic
992579097 5:78152095-78152117 GAGAGGGAAGGGAAAGGAGAGGG - Intronic
993055413 5:82974789-82974811 CTAGGGGAAGGGGAAGGAGAGGG - Intergenic
993834557 5:92801828-92801850 TTCTGGGAAATAAAAGGAGAGGG + Intergenic
994048441 5:95335237-95335259 GTAAGGGAAGGGAAGGGAGAAGG - Intergenic
994728646 5:103465547-103465569 AGCTGGGAAGGGTAAGGAAATGG - Intergenic
994890207 5:105623606-105623628 CTCTGGGAAAGGAACAGAGAGGG + Intergenic
995715882 5:115081608-115081630 CTCTGGTTAGGAAAAGAAGATGG + Intergenic
997104762 5:131005960-131005982 CTCTGGTTATGGAAAGGGGAGGG + Intergenic
997209127 5:132067407-132067429 CTCATGGAAGGGAAAGGGAAGGG - Intergenic
997309346 5:132866747-132866769 CGCTGGGCTGGGAAAGGATAAGG + Intronic
997337512 5:133118646-133118668 ACCAGGGAAGTGAAAGGAGAAGG + Intergenic
997426311 5:133805068-133805090 TTCTGGGAGGGGCAAGCAGAGGG - Intergenic
997881347 5:137593790-137593812 CTCTGGGTAGGAGAAGTAGATGG + Intronic
997885427 5:137625719-137625741 CTCTCGGATGGGCATGGAGATGG + Intronic
998264820 5:140659965-140659987 CTCTGGGAAGGAACAAGGGATGG - Intronic
998354926 5:141527066-141527088 CTCTGGGGAGGGGAAAGAGAGGG + Intronic
998371058 5:141661788-141661810 CTCTGGGGATGGAATGGAGGAGG + Exonic
998552784 5:143093735-143093757 CTAGGGGAAGGGGAAGGAGAGGG - Intronic
999059980 5:148623373-148623395 CTGTGGGAAGAGACAAGAGATGG + Intronic
999096220 5:148980193-148980215 CTCTGGGAATGGAATAGAAAAGG - Intronic
999801344 5:155040611-155040633 CTCTGGGAGGAGAAAAGAGCTGG + Intergenic
1000203820 5:159038098-159038120 CTCTGGGATTGCAAAGGACAAGG - Intronic
1000533529 5:162453206-162453228 CACACTGAAGGGAAAGGAGAAGG - Intergenic
1001092120 5:168749414-168749436 CCCTGGGAAGGCAAGGAAGATGG - Intronic
1001240232 5:170063320-170063342 CTCTGGGAACAGAAGGGAGCAGG + Intronic
1001253509 5:170166485-170166507 CAAGGGGAAGGGAAGGGAGAGGG + Intergenic
1001517103 5:172363665-172363687 CTCTGAGATGGGAAAGGACTTGG + Intronic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1002295473 5:178228501-178228523 CTCTGGAAAGAGAAGGGAGCTGG - Intronic
1002500946 5:179647297-179647319 CTCTGGGAAGGGAAGTGGCATGG + Intergenic
1002716914 5:181233789-181233811 GTCTGTGAAGGGAAAGGCAAAGG - Intronic
1002809270 6:611096-611118 CTCTCTGTAAGGAAAGGAGATGG + Intronic
1002809279 6:611166-611188 CTCTCTGTAAGGAAAGGAGATGG + Intronic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003121802 6:3324181-3324203 AACTGGGAAGGGAAGTGAGACGG + Intronic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1003884764 6:10511722-10511744 GAATGGGAAGGGAAAGGAGCAGG + Intronic
1003965522 6:11248957-11248979 CTCTGGGGAGAGAGAAGAGAAGG - Intronic
1004116384 6:12771832-12771854 CTCTGGGGAGGGATAGAAGTTGG + Intronic
1004296875 6:14420975-14420997 CTGTGGGAAAGCAAAGGAGGAGG - Intergenic
1005258152 6:24026949-24026971 CTGAGGGAAGGGGAAGGAGCAGG - Intergenic
1005377583 6:25199739-25199761 TGCTCGGTAGGGAAAGGAGAAGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006093971 6:31644472-31644494 CTCTGGGTAGAGAAAGGGAAGGG - Intronic
1006134927 6:31889341-31889363 CTCTGGGAAGGGGGAGGAGGAGG + Exonic
1006303608 6:33206877-33206899 TTCGGGAAAGGGAAAGGAGGGGG - Intergenic
1006325331 6:33349405-33349427 CTTTAGGAAGGTAAAGGTGAGGG - Intergenic
1006601377 6:35228734-35228756 GTCTGGGTAAGCAAAGGAGAGGG + Exonic
1007136766 6:39529972-39529994 CTCTGTGAATTCAAAGGAGAAGG - Intronic
1007169434 6:39852330-39852352 CCCTGGACAGGGAGAGGAGAAGG - Intronic
1007422764 6:41729332-41729354 GTCTGGGAGAGGAAAGGAAAAGG + Intronic
1007916359 6:45565274-45565296 CTCTGGGCAGGGTCAGGAGGTGG + Intronic
1008560907 6:52723744-52723766 CTTTGGGAAGCCAAAGCAGACGG - Intergenic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1008588420 6:52969923-52969945 CTATGGATAGAGAAAGGAGAGGG + Intergenic
1008707289 6:54178045-54178067 CTCTCGGGAGGGTAGGGAGAGGG + Intronic
1008862977 6:56173369-56173391 CAAAGGAAAGGGAAAGGAGAAGG + Intronic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009577217 6:65480950-65480972 TGCTGGGAAGGGTAGGGAGAAGG + Intronic
1009635554 6:66259981-66260003 CTAGGAGAAGGGGAAGGAGAGGG + Intergenic
1010081435 6:71868682-71868704 CTTTGGGAAGCCAAAGCAGAAGG + Intergenic
1010267994 6:73889210-73889232 GGCTGGGAAGGGTAGGGAGAGGG - Intergenic
1010320224 6:74498575-74498597 CTCTGATAGGGGAAAGGAAATGG - Intergenic
1010931331 6:81807251-81807273 GTCTGGGAAGTCAAAGGATATGG + Intergenic
1011164236 6:84428105-84428127 CTGTGGGGAGGGGAAGGAAATGG - Intergenic
1011570132 6:88725813-88725835 CTAGGGGAAGGGGAAGGAGAGGG + Intronic
1011825599 6:91302099-91302121 CTTTGGGAAGCCAAAGCAGAAGG - Intergenic
1012122104 6:95381667-95381689 CTTTGGGAAGGAGAATGAGAAGG - Intergenic
1012396211 6:98800636-98800658 GTTTGGGAAGCGAAAGGAAAGGG - Intergenic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013087589 6:106869584-106869606 CTCTGATACGGGAAAGGGGAGGG + Intergenic
1013250878 6:108332014-108332036 CTCTTGGAAGGGTGAGGAGGAGG - Intronic
1013384491 6:109611652-109611674 CACTGGAAAGGGAAAGGAAAAGG - Intronic
1013421076 6:109967531-109967553 CCCTGGGAAGGAAAAGTGGAGGG + Intergenic
1013917837 6:115363587-115363609 CTATGGGAAAGGAAGTGAGATGG - Intergenic
1014110871 6:117617397-117617419 CTAGGGGAAGGGGAAAGAGAGGG + Intergenic
1014159694 6:118153875-118153897 GTCTGGGAATGGACAGCAGATGG + Intronic
1014263055 6:119241865-119241887 CTGGGGGAAGGGAAAGATGAAGG + Intronic
1014418318 6:121211461-121211483 CAATGGGAAAGGATAGGAGAGGG - Intronic
1014703251 6:124715403-124715425 CACAGGGAGGGGAGAGGAGAAGG - Intronic
1015352727 6:132241681-132241703 GTTTGGGCAGGGAATGGAGATGG - Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1016531714 6:145065682-145065704 CTCTGTGCAGGGAAAAGAGGAGG + Intergenic
1016727569 6:147392750-147392772 CTCTGGGAAGTCAAGGGAGGAGG - Intergenic
1017339634 6:153305436-153305458 GTAGGGGAAGGGGAAGGAGAAGG - Intergenic
1017497478 6:154994943-154994965 CTCTCAGAAGGGGAAGGAGATGG + Intronic
1017975623 6:159354461-159354483 CTCTGTGCAGGCATAGGAGATGG + Intergenic
1018137357 6:160790277-160790299 CTAGGGGAAGGGGAAGGGGAAGG + Intergenic
1018167898 6:161116444-161116466 CCCTGGGAAAGGAAAGGAAGGGG + Intronic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018191611 6:161314361-161314383 CTAGGGGAAGGGGAAGGAGAGGG - Intergenic
1018336332 6:162793850-162793872 CTCTGAGGAGGGAAAGGATCAGG + Intronic
1018733863 6:166673021-166673043 CTCTGGGGAGGGCTGGGAGAGGG - Intronic
1018872493 6:167794253-167794275 CTCCAGGAAGGGAGAGGCGATGG + Intronic
1018906541 6:168079197-168079219 CACTGGGAAGGGAATTGAGAGGG + Intronic
1019255957 7:51160-51182 GGCTGGGAAGGGGAGGGAGAGGG + Intergenic
1019296222 7:276741-276763 CTCTTGGAAGGGTCAGGAGCAGG - Intergenic
1019376809 7:697180-697202 CTGTGGGACGGGATAGGAGCAGG - Intronic
1019477886 7:1252727-1252749 CCCAGGGCAGGGAAAGGAGCAGG + Intergenic
1019494539 7:1331658-1331680 CTCTGGGGAGAGGAAGCAGATGG - Intergenic
1020572489 7:9883444-9883466 CTATGGGGAGGGTAAGCAGAAGG - Intergenic
1021583213 7:22178815-22178837 GTCTGGGGAGGGGAGGGAGATGG - Intronic
1021612654 7:22473233-22473255 CCCTTGGAAGGGAAAGAGGAAGG + Intronic
1021842724 7:24733687-24733709 CTCTGCCTGGGGAAAGGAGAGGG + Intronic
1022016885 7:26357837-26357859 CTGTGGGAAGGGTATGGACATGG + Intronic
1022074758 7:26956370-26956392 CTCGGGGAAGTCAAGGGAGAAGG + Intronic
1022250872 7:28607104-28607126 GTCTGGGAAGGGCAGGGAGAAGG - Intronic
1022532034 7:31072977-31072999 CTCTGGAAAAGGCAAGGAAATGG + Intronic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1022652393 7:32289159-32289181 CTTTGGGAGGGCAAAGCAGAAGG + Intronic
1023227653 7:37987905-37987927 CAGTGGGAAGGGAAATGAAATGG - Intronic
1023436639 7:40147148-40147170 CTAGCGGAAGGGGAAGGAGAGGG - Intronic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1023911254 7:44558488-44558510 GTCAAGGAAAGGAAAGGAGAGGG - Intergenic
1024119388 7:46221661-46221683 ATCTGGGAAGGGCAGGTAGATGG + Intergenic
1024208608 7:47184821-47184843 CTCTGGGGTGGGAGAGGAGGAGG + Intergenic
1024527150 7:50358408-50358430 CTGTGGGACGGGGCAGGAGAGGG + Intronic
1024787121 7:52921240-52921262 TTCTGGGAGGGGAAAGGAGTAGG + Intergenic
1025074013 7:55926892-55926914 CTTTGGGAAGCCAAAGCAGATGG + Intronic
1025225403 7:57155906-57155928 CTCTTGGCAGGGAAAAAAGAAGG - Intergenic
1025986643 7:66458715-66458737 CAATGGGAAGGGAAAGATGACGG + Intergenic
1026036914 7:66836605-66836627 CTCTGGGCAGGGACAAGGGAGGG - Intergenic
1027209915 7:76137566-76137588 CACTGGGAAGGGAAAGACGACGG + Intergenic
1027978104 7:85184971-85184993 CTCGGAGAAGGAAAAGGAGAAGG + Intronic
1028111045 7:86941747-86941769 CAATGGGAAGGGGAAGGAAAAGG + Intronic
1028793525 7:94879003-94879025 CGAGGGGAAGGGGAAGGAGAGGG + Intergenic
1028941482 7:96526729-96526751 CTCTGAAAGGAGAAAGGAGAGGG - Intronic
1029841145 7:103364649-103364671 CTCTGGGAGGCCAAAGCAGATGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1032188746 7:129750383-129750405 CCCTGGCAAGGGAAAGGGGGAGG - Intronic
1032395106 7:131583764-131583786 CTCTGGGAGGCGAAAGTGGAAGG + Intergenic
1032478245 7:132226830-132226852 CTCAGGGAAGGCAAAGAACAAGG - Intronic
1032489012 7:132309937-132309959 ATCTGGGATGTGAAGGGAGAGGG - Intronic
1032548832 7:132765829-132765851 CTCTGGGATGAGCAAGGAGCCGG + Intergenic
1032558619 7:132864285-132864307 CTCAGGGGAGGGAAAAGAGATGG + Intronic
1032687669 7:134252088-134252110 CTTTGGGAAGGCAAGGTAGAAGG + Intronic
1033183576 7:139204246-139204268 AGCTGGAAAGGGAAAGGAAATGG + Intergenic
1033361224 7:140640447-140640469 AGCTGGGGAGGGAAAGGGGACGG - Intronic
1033503477 7:141977003-141977025 TTCTGGTAAGGGAAAGGAATGGG + Intronic
1033639387 7:143246703-143246725 ATGTGGGAAGGGAAGGGATATGG - Intronic
1034076754 7:148239398-148239420 CTATGGGAAGAGAAGAGAGAGGG + Intronic
1034159577 7:148983174-148983196 CGTTGGGAAGGAAAAGGGGAGGG + Intergenic
1034555143 7:151845609-151845631 CGCTGGGAAGGGAAAGGCGGTGG + Intronic
1034602032 7:152268034-152268056 CTCTGGGAGGCCAAAGCAGATGG + Intronic
1034657272 7:152739652-152739674 CTCTGGGAGGCCAAGGGAGAAGG - Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036091423 8:5669750-5669772 GTCAGGGAATGCAAAGGAGAAGG - Intergenic
1036667097 8:10753648-10753670 CTTTGGGAGGCCAAAGGAGAAGG - Intronic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037456511 8:19069366-19069388 ATGGGGGAAGGGAAAGGAAAAGG + Intronic
1037774356 8:21823144-21823166 CTCTAGGAAGGGAAGTGAGTGGG - Intergenic
1037812457 8:22095151-22095173 CTCCAGGAAGGGAAAAGTGAGGG - Intronic
1037897807 8:22669824-22669846 CTCTGGGAAGGAACAAGAGCAGG - Intergenic
1038138528 8:24816899-24816921 ATGTGGGAAGAGAAAAGAGAAGG - Intergenic
1039055036 8:33529258-33529280 CTCTGGGAGGCCAAAGGAGAAGG - Intergenic
1039099946 8:33930231-33930253 CTTTGGGATGGTGAAGGAGAGGG - Intergenic
1040915454 8:52563813-52563835 CCCTGGGGAGGGGATGGAGAAGG - Intronic
1041210172 8:55542204-55542226 GGATGGGAAGGGAAAGGAGGCGG + Intergenic
1041289209 8:56292973-56292995 TTCAGGGAAGGAAGAGGAGATGG - Intergenic
1041740721 8:61153691-61153713 CTCAGGGCTGGGAAAGGAGATGG + Intronic
1041934869 8:63323464-63323486 AGCTGGGAGGGGAAAGGATAAGG - Intergenic
1042061699 8:64824725-64824747 GTTTGGGAAGGGAAAGGAAGAGG + Intergenic
1042286042 8:67111479-67111501 CTCTGAGAATAGAAAGGAGGGGG + Intronic
1042298780 8:67252419-67252441 AGCTGGAAATGGAAAGGAGATGG - Intronic
1042472646 8:69208915-69208937 CTCTGGGAAGGCTGAGGAGAAGG - Intergenic
1042502646 8:69526222-69526244 CTCTGTGACTGGATAGGAGAGGG - Intronic
1042672811 8:71283125-71283147 CTCTGGGAAAGGAAAGTGGGAGG - Intronic
1043106807 8:76124184-76124206 TTCTTGGAATGGAAAGGAAATGG + Intergenic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043154007 8:76754838-76754860 CACTGGGAAGGGTAAGAGGAAGG - Intronic
1043503182 8:80876046-80876068 CTTTGGGAATGGAAAGGAAGGGG - Intergenic
1043941926 8:86205609-86205631 GGGAGGGAAGGGAAAGGAGAAGG + Intergenic
1044078474 8:87854685-87854707 CCCAGGGAAGGGCAAGAAGAAGG + Intergenic
1044184888 8:89239702-89239724 CTAGGGGAAGGGGAAGGGGAAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045009646 8:97946556-97946578 TTCTGGGAAGGGGAAGGATAAGG - Intronic
1045327514 8:101127705-101127727 CTATGAGAGGGGAAAGGAGGGGG - Intergenic
1045536998 8:103039724-103039746 GTGTGGGAAGGGGAAGGAGGAGG + Intronic
1045572263 8:103380447-103380469 CTCTCTTAAGGGAAAGGAAAGGG + Intronic
1046001470 8:108425462-108425484 CTTTGGGAAGCCAAAGCAGAGGG - Intronic
1046138442 8:110061017-110061039 AGCTGGGAGGGGAAAGGATAAGG - Intergenic
1046155120 8:110278698-110278720 CACTGGTAAGGAACAGGAGATGG + Intergenic
1046221830 8:111226795-111226817 TTAAGGGAAGGGAAAAGAGAGGG - Intergenic
1046606324 8:116375414-116375436 GTCTGGGCATGGAATGGAGAGGG + Intergenic
1047373104 8:124272467-124272489 CTCTGGGAATGGAAGGGATTAGG + Intergenic
1047741446 8:127810090-127810112 CTCTGGAAAGGGAGAGGAGCAGG + Intergenic
1047903008 8:129444074-129444096 GTTTGGCAAGGGAAAGGAGCAGG - Intergenic
1048350512 8:133612049-133612071 CTCTGGGAATGGGATGGAGTAGG + Intergenic
1048375021 8:133815798-133815820 CTATAGGAAGAGAAGGGAGAAGG + Intergenic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1048573879 8:135676153-135676175 CTGTGAGAAGGGAAAGGACTTGG + Intergenic
1048607041 8:135979860-135979882 TCCTGGGAGGAGAAAGGAGAAGG - Intergenic
1048842443 8:138577594-138577616 CTCTGGGAACTGTAAGGAAAAGG + Intergenic
1049069979 8:140349033-140349055 CCTTGGCAAGGGAGAGGAGAGGG + Intronic
1049189837 8:141280873-141280895 CCCAGGGGAGGGAAAGGAAAAGG + Intronic
1049210737 8:141385342-141385364 TTCTGGGAAGGGACAAGAGACGG - Intergenic
1049260764 8:141637898-141637920 CCCTGGCGAGGGAAAGGAGTAGG + Intergenic
1049461605 8:142732070-142732092 CCAGGGGAAGGGGAAGGAGAGGG - Intronic
1049686541 8:143941442-143941464 CTCAGGGAAGGGAAGGGGCACGG + Intronic
1050127611 9:2375739-2375761 GGCTGGGAAGGGTAAGGAGAAGG + Intergenic
1050209493 9:3237570-3237592 TTATGGAAAGGGGAAGGAGATGG + Intronic
1050422640 9:5482737-5482759 CGGTGGGAAGGGAAAGCAGTGGG - Intergenic
1050727686 9:8670300-8670322 GTCAGGGGAGGGAAAGGAAATGG - Intronic
1051207281 9:14701488-14701510 CTCTGGGAAAGGAGATGAAAAGG + Intergenic
1051845615 9:21448349-21448371 CTCTGGGGAGAGAAAGGGGCAGG + Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052100187 9:24436634-24436656 CTTTGGGAGGCCAAAGGAGAAGG - Intergenic
1053001841 9:34580957-34580979 CTCTGGAAAAAGAAAGGACAGGG + Intronic
1053062917 9:35045413-35045435 CTCAGGCAAGAGAAAGGACAAGG + Exonic
1053823229 9:41991237-41991259 GGCGGAGAAGGGAAAGGAGAAGG + Intronic
1054607344 9:67196128-67196150 GGCGGAGAAGGGAAAGGAGAAGG - Intergenic
1054771435 9:69087940-69087962 CTCTGAGAAGAAGAAGGAGAAGG - Intronic
1054859504 9:69934256-69934278 CTTTGGGAAGAAAAAGCAGAAGG + Intergenic
1054955973 9:70910400-70910422 GACTGGGAAGGGACAGGAGTAGG + Intronic
1055354746 9:75426358-75426380 CGAAGGGAAGGGAAGGGAGAAGG - Intergenic
1055371395 9:75603463-75603485 AGCGGGGGAGGGAAAGGAGATGG - Intergenic
1055636331 9:78282598-78282620 CACTGGGGAGGCAAGGGAGAGGG + Intergenic
1055787106 9:79883286-79883308 CTCTGGGGAGAGGAAGGAGTGGG + Intergenic
1055787201 9:79883804-79883826 CTCTTGCAAGAGAATGGAGAGGG + Intergenic
1055815634 9:80201950-80201972 CTCAGGGAAGGCAAAGGAGCTGG - Intergenic
1056166363 9:83944910-83944932 GTATTGGAAGGAAAAGGAGATGG - Exonic
1056337117 9:85583004-85583026 CTCTCATAAGGGAAAGGGGAAGG + Intronic
1057139270 9:92716925-92716947 ATCTGGGGAGGGTGAGGAGAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058074120 9:100633504-100633526 CTTTGGGAAGCCAAAGTAGAAGG - Intergenic
1058766648 9:108188617-108188639 TTCCAGGAAGGGAGAGGAGAAGG + Intergenic
1058811020 9:108639608-108639630 GTCTGGAAAGGGAGAGGAGAGGG - Intergenic
1059035426 9:110748882-110748904 CACTGGGGGGAGAAAGGAGAGGG - Intronic
1059511292 9:114850559-114850581 CTTTGGGAAAGGAATGGAGTAGG + Intergenic
1059542510 9:115144337-115144359 AAAAGGGAAGGGAAAGGAGAAGG - Intronic
1059617420 9:115966510-115966532 ATTTGGGAAGGTAAAGGAGAAGG + Intergenic
1059644521 9:116251463-116251485 CACAGGGAGGAGAAAGGAGATGG + Intronic
1059776305 9:117478738-117478760 CTCAGGAAAGGAAAAGGAGGAGG - Intergenic
1059898622 9:118896403-118896425 CTCTGGGCAGAGGGAGGAGATGG + Intergenic
1059934790 9:119298822-119298844 GTATGTAAAGGGAAAGGAGAGGG - Intronic
1060042873 9:120315944-120315966 CTCTGGCTAGAGAAAGCAGAGGG + Intergenic
1060069624 9:120534714-120534736 GCCTGTGAAGGGGAAGGAGAGGG - Intronic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1060358273 9:122931250-122931272 CACAGGGAAGGGAAAGGGGCGGG + Intronic
1060507485 9:124209012-124209034 CTCTGGGAAGAGAAGGGACATGG - Intergenic
1060673323 9:125489969-125489991 TTGAGGGAAGGGAAAGGAGAAGG - Intronic
1060745457 9:126127982-126128004 CTCTGGGCACTGAAAGAAGAGGG + Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060817831 9:126644703-126644725 CTCAGGGAAGGGCAGGGACACGG - Intronic
1061099896 9:128484629-128484651 TTGTGGGAAGGCAAAGCAGAGGG - Intronic
1061169011 9:128941315-128941337 TTCAGGGAAGGGAATGGGGATGG + Intronic
1061232188 9:129321396-129321418 CACTGGGCAGGGAAAGGCGAAGG - Intergenic
1061398889 9:130357813-130357835 CTCTGGGAAGGGAAAGAGTCAGG - Intronic
1062147943 9:135000569-135000591 ATCTGCGAAGGGGAAGCAGATGG - Intergenic
1062182060 9:135196208-135196230 AACTGGGAAGGGAAATGGGAAGG - Intergenic
1062323275 9:136000948-136000970 CGGTGGGGAGGGAAAGGAGTGGG + Intergenic
1185504685 X:623765-623787 CCCTGGGGAGAGAAAAGAGAAGG + Intergenic
1185615737 X:1420656-1420678 TTCTGGGCGGGGAAAGGGGAAGG + Intronic
1185836197 X:3347205-3347227 CTCTGGCAAGGGGAGGGAGGCGG - Intergenic
1185943574 X:4348781-4348803 GGCTGGGAAGGGAAAAGAGAAGG - Intergenic
1186326382 X:8482021-8482043 CCTAGGGAAAGGAAAGGAGAAGG - Intergenic
1186456682 X:9715170-9715192 CTCTGGAAGGGACAAGGAGAAGG - Intronic
1186503003 X:10066851-10066873 GTCTGGAAAATGAAAGGAGAAGG + Intronic
1186507764 X:10107487-10107509 CTGTGGGAAGTGACAGGACATGG + Intronic
1186666620 X:11723429-11723451 CGCTTGGAAAAGAAAGGAGAAGG + Intergenic
1186997377 X:15138364-15138386 CACTGGTAGGGGAGAGGAGAAGG + Intergenic
1187089248 X:16077428-16077450 AACTGTGAAGGGAAAGGGGAAGG + Intergenic
1187348355 X:18488568-18488590 TTCTGGGAGGGGAAAAGGGAAGG + Intronic
1187754560 X:22508195-22508217 CTGTTGGAAGTGACAGGAGAGGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188236585 X:27739217-27739239 GTTTGGGGAGAGAAAGGAGAGGG - Intronic
1188606359 X:32035993-32036015 ATCTGGGAAGGAAAAGGGAAAGG + Intronic
1188714234 X:33441545-33441567 CTCTCTCAAGAGAAAGGAGAAGG - Intergenic
1190203180 X:48381444-48381466 GGAAGGGAAGGGAAAGGAGAAGG - Intergenic
1190203195 X:48381486-48381508 AGAAGGGAAGGGAAAGGAGAAGG - Intergenic
1190207341 X:48413918-48413940 AGAAGGGAAGGGAAAGGAGAAGG + Intergenic
1190207356 X:48413960-48413982 GGAAGGGAAGGGAAAGGAGAAGG + Intergenic
1190358490 X:49627418-49627440 GCCTGGGATGGGAAACGAGAGGG - Intergenic
1190472594 X:50797890-50797912 CACTGGGAAGGGAAATTAGGTGG + Intronic
1190831632 X:54063963-54063985 CTCTGGGGAAGGTAAAGAGATGG + Intergenic
1191283797 X:58702771-58702793 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191289279 X:58776368-58776390 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191301677 X:58941373-58941395 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191305510 X:58992041-58992063 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191309046 X:59039359-59039381 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191317454 X:59151827-59151849 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191328822 X:59304039-59304061 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191338158 X:59429017-59429039 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191340773 X:59463986-59464008 TTCTGTGAAGAGAAAGGAAAAGG - Intergenic
1191348516 X:59567232-59567254 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191353996 X:59640577-59640599 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191354146 X:59642635-59642657 TTCTGTGAAGTTAAAGGAGAAGG - Intergenic
1191361509 X:59740876-59740898 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191362424 X:59753222-59753244 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191367533 X:59821269-59821291 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191376994 X:59947782-59947804 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191391792 X:60145609-60145631 TTCTGTGAAGAGAAAGGAAAAGG - Intergenic
1191392256 X:60151781-60151803 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191393471 X:60168235-60168257 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191399306 X:60246394-60246416 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191403636 X:60304332-60304354 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191409258 X:60379903-60379925 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191412684 X:60426012-60426034 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191416547 X:60477422-60477444 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191427153 X:60619436-60619458 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191432638 X:60693477-60693499 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191464269 X:61116063-61116085 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191469286 X:61183593-61183615 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191477173 X:61289359-61289381 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191497305 X:61558521-61558543 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191497760 X:61564692-61564714 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191498506 X:61574636-61574658 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191499583 X:61589037-61589059 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191507720 X:61697726-61697748 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191514279 X:61785642-61785664 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191520882 X:61873933-61873955 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191533524 X:62042815-62042837 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191535032 X:62063039-62063061 TTCTGTGAAGTTAAAGGAGAAGG - Intergenic
1191543969 X:62182801-62182823 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191545195 X:62199262-62199284 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191547497 X:62229954-62229976 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191558078 X:62371362-62371384 TTCTGTGAAGGTAAAGGAAAAGG - Intergenic
1191725196 X:64271887-64271909 CCCTGGGAAGGGAAAAGAGTTGG + Intronic
1191860810 X:65665561-65665583 GTCTGGGAAGGCAAAGGAAGAGG + Intronic
1192030637 X:67509082-67509104 ATGTGGGAAGGGCAAGGAGTGGG + Intergenic
1192233172 X:69279607-69279629 CTCTGGAAAGGCAAAGGGAATGG - Intergenic
1192330102 X:70168475-70168497 CACTGAGAAGGGAAAGGAAATGG + Intergenic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1192817955 X:74614192-74614214 CTCTTTGAAGGGGAAGGAGGTGG - Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193078281 X:77378906-77378928 CTCTGAGAAGTGAAATGAGGAGG + Intergenic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1194177757 X:90672885-90672907 CTCTGGGAGGCCAAAGCAGATGG + Intergenic
1195082370 X:101383900-101383922 ATCTGGGGAGGGGAAGGAGGAGG - Intronic
1195127510 X:101822773-101822795 ATCTGGGAAGTGCAAGGAGCAGG - Intergenic
1195299496 X:103513297-103513319 CACAGGGGAGGGAAAGGGGAGGG + Intronic
1195908080 X:109864930-109864952 TTCTGGGAAGGGCCAGAAGAAGG + Intergenic
1196018089 X:110960646-110960668 TTCTGGGTAGGGAAAGGAATAGG + Intronic
1196251550 X:113465958-113465980 GTTTGGGAAGAGAAAGGGGAGGG + Intergenic
1196286090 X:113882137-113882159 CTTTGAGAAGGGAAAGGCGCTGG - Intergenic
1196636203 X:118005690-118005712 CGCTGGGAAAGGCAAGGAAACGG + Intronic
1196874359 X:120144179-120144201 CTAGGGGAAGGGGAAGGAGAGGG + Intergenic
1197118614 X:122863742-122863764 CTTTGGGAGGGCAAAGCAGAGGG + Intergenic
1197251164 X:124217778-124217800 GTCTGGGAAATGTAAGGAGAGGG - Intronic
1197272130 X:124436420-124436442 CTCAGGGTAGGGAGAGGAGCTGG - Intronic
1197666925 X:129234136-129234158 CTCTGGGAATGCAAGGGAGTGGG + Intergenic
1198056519 X:133001150-133001172 CTCTGGGAAGCGGAGGCAGATGG + Intergenic
1198546981 X:137702685-137702707 CTCTGGGGAAGGAAAGCAAAGGG - Intergenic
1198742229 X:139853204-139853226 CTAGGGGAAGAGGAAGGAGAGGG + Intronic
1198811864 X:140543985-140544007 CTCTGGGAAGGGAAATGGAAAGG + Intergenic
1199005780 X:142694127-142694149 CTCTGCCTATGGAAAGGAGAGGG + Intergenic
1199261447 X:145779977-145779999 CTCTACTAAGGCAAAGGAGAGGG + Intergenic
1199275001 X:145930582-145930604 GTCTGGGAAGGGAAGGGAGCGGG - Intergenic
1199374189 X:147088090-147088112 CTCTGCGTTTGGAAAGGAGATGG - Intergenic
1199582350 X:149372910-149372932 CTATGGGGAGGGGAAGGAGAAGG + Intergenic
1199637518 X:149827167-149827189 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
1199637854 X:149830218-149830240 CTAAGGGAAGGGAAAGGAGAAGG + Intergenic
1199744560 X:150763783-150763805 CTCTGGGAAGGGAAAACCAAGGG - Intronic
1199799363 X:151234243-151234265 GGCTGGGAAGGGGAAGGGGAAGG + Intergenic
1199966439 X:152824489-152824511 GTGGGGCAAGGGAAAGGAGAGGG - Intergenic
1199977758 X:152904390-152904412 CTCTGGGAAGGGGATGGAGCAGG - Intergenic
1199986320 X:152954387-152954409 TTCTGTCAAGGCAAAGGAGAGGG + Intronic
1200364222 X:155644577-155644599 CTCTGCCTATGGAAAGGAGAGGG - Intronic
1200763495 Y:7061608-7061630 CTAGGGGAAGGAGAAGGAGAGGG - Intronic
1200822177 Y:7597860-7597882 CTCTGGGCAGCCAAAGGAGTGGG + Intergenic
1200831817 Y:7692987-7693009 CTCAGGGCAGGGGAAGGAGCTGG - Intergenic
1201018396 Y:9626659-9626681 CTCAGGGCAGGGAAAAGAGCGGG - Intergenic
1201075622 Y:10185193-10185215 CTCTGGCAAGGGGTGGGAGAAGG - Intergenic
1201581830 Y:15517914-15517936 ATTTGGGTAGGTAAAGGAGAAGG - Intergenic
1201598226 Y:15696094-15696116 TGCTGGGAAGGGAAGGGAAAAGG + Intergenic
1202238124 Y:22736157-22736179 CTCTGGGCAGCCAAAGGAGTGGG - Intergenic