ID: 1188003888

View in Genome Browser
Species Human (GRCh38)
Location X:25004751-25004773
Sequence CCTCTAGCATAGCCGCGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188003888_1188003891 1 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003891 X:25004775-25004797 GCGTCTGTCTGCGGCCGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 76
1188003888_1188003890 -8 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003890 X:25004766-25004788 GCTAGAGGCGCGTCTGTCTGCGG 0: 1
1: 0
2: 0
3: 1
4: 49
1188003888_1188003896 15 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003896 X:25004789-25004811 CCGCCGTGGCCGGGTCGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 149
1188003888_1188003892 5 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003892 X:25004779-25004801 CTGTCTGCGGCCGCCGTGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 133
1188003888_1188003893 6 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003893 X:25004780-25004802 TGTCTGCGGCCGCCGTGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 110
1188003888_1188003894 10 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003894 X:25004784-25004806 TGCGGCCGCCGTGGCCGGGTCGG 0: 1
1: 0
2: 0
3: 14
4: 135
1188003888_1188003897 16 Left 1188003888 X:25004751-25004773 CCTCAGCGCGGCTATGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1188003897 X:25004790-25004812 CGCCGTGGCCGGGTCGGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188003888 Original CRISPR CCTCTAGCATAGCCGCGCTG AGG (reversed) Exonic
901134701 1:6985351-6985373 CCTCTTGCAAAGCCAGGCTGTGG - Intronic
912097336 1:106161532-106161554 CCTCTAAAATGGCCGCTCTGGGG + Intergenic
914985026 1:152449203-152449225 ACTCTAGCACAGCCACGTTGGGG - Intergenic
1063667169 10:8069755-8069777 TGTCTAGCATAGCCGTGCTGAGG + Intronic
1065512481 10:26493004-26493026 CCTCTAAAATGGCCGCTCTGGGG - Intronic
1073569001 10:104560185-104560207 CCTCCAGCATAGCAGCGTGGGGG - Intergenic
1098105925 12:67069192-67069214 CCTCTAGGGCAGCCGCGCCGGGG + Intergenic
1102436327 12:112926867-112926889 CCTCTAAAATGGCCGCTCTGGGG - Intronic
1104943275 12:132404697-132404719 CCTCTGGCCTAGCCCTGCTGGGG - Intergenic
1105820309 13:24075116-24075138 CCTCTAGCAGAGCAGGACTGGGG - Intronic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1109132987 13:58611603-58611625 CCTCTAACATAGGCCCACTGCGG + Intergenic
1120993244 14:90396940-90396962 CCTCGCGCAGAGCGGCGCTGCGG - Intronic
1133294486 16:4744683-4744705 CCTCTAGCTCAGCAGGGCTGAGG - Intronic
1141961946 16:87414627-87414649 CCTGTATCAAAGCCGCCCTGTGG - Intronic
1144208560 17:12996091-12996113 CCTCTAACACAGCCGCAGTGGGG + Intronic
1156865144 18:41880650-41880672 CCTCTAGCATAGAAGTCCTGGGG - Intergenic
1157418510 18:47526070-47526092 CCTCTTGCAAAGCCGCGGGGAGG + Intergenic
925305930 2:2848508-2848530 CCACCAGCACAGCCGCCCTGTGG + Intergenic
927319662 2:21728300-21728322 CCTCTAGAATGGCCTCCCTGTGG - Intergenic
928897194 2:36279609-36279631 CCTCTAAAATGGCCGCTCTGGGG + Intergenic
932366552 2:71156841-71156863 CCTCTAGTATTGCAGAGCTGGGG - Intergenic
934690303 2:96353570-96353592 CCTCTAGAATAGTCCTGCTGGGG - Intronic
948400054 2:237677737-237677759 CCTCTAGCACAGCCTACCTGTGG + Intronic
1170506128 20:17027492-17027514 CCTCTAAAATGGCCGCTCTGGGG + Intergenic
1170781829 20:19432191-19432213 CCTCTAGGATACCCGCATTGGGG - Intronic
1180082216 21:45492121-45492143 CTCCTAGCAAAGCCGTGCTGGGG - Intronic
949638890 3:6013410-6013432 CCTCTAAAATGGCCGCTCTGGGG + Intergenic
949787883 3:7761705-7761727 CCTCTAAAATGGCCGCTCTGGGG + Intergenic
956235028 3:67060231-67060253 CCTCTAAAATGGCCGCTCTGTGG + Intergenic
970742652 4:19255821-19255843 CCTCTAAAATGGCCGCTCTGGGG - Intergenic
1018982689 6:168612739-168612761 CCTCTTGCATTGCCGCGCCGAGG - Intronic
1024946124 7:54809050-54809072 CCTCTAAAATAGCCACTCTGGGG + Intergenic
1035282987 7:157788857-157788879 CCTCCAGCATAGCAGAGATGTGG - Intronic
1045824634 8:106382600-106382622 CCTCTAGCAGAGCTGGGCTGTGG - Intronic
1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG + Intergenic
1062525717 9:136977355-136977377 CCTCTTGCATAAGCGCCCTGTGG + Intergenic
1186994545 X:15105989-15106011 CCTCTAGAATGGCTGCTCTGGGG - Intergenic
1188003888 X:25004751-25004773 CCTCTAGCATAGCCGCGCTGAGG - Exonic
1190152801 X:47962256-47962278 CCTCTAAAATGGCCGCTCTGGGG - Intronic