ID: 1188004574

View in Genome Browser
Species Human (GRCh38)
Location X:25008202-25008224
Sequence AGGGATACACAACCTGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188004573_1188004574 -6 Left 1188004573 X:25008185-25008207 CCTCTATGAAATGAAACAGGGAT 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1188004574 X:25008202-25008224 AGGGATACACAACCTGCTCTTGG 0: 1
1: 0
2: 4
3: 27
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188004574 Original CRISPR AGGGATACACAACCTGCTCT TGG Intronic
902624217 1:17667326-17667348 AGAGAGACACAGCCTGCCCTTGG + Intronic
902763757 1:18601200-18601222 AGAGCTACAAAACCTTCTCTGGG - Intergenic
905885598 1:41490182-41490204 GGGGAGACACACCCAGCTCTAGG - Intergenic
906932136 1:50180413-50180435 AGGGATACTCAACCTGTACTAGG + Intronic
916717454 1:167457205-167457227 ATGGAGCCACAAGCTGCTCTGGG + Intronic
920098367 1:203500798-203500820 TGGGATACTCAACCTGTACTGGG + Intronic
1063875263 10:10469918-10469940 AGGGATGCTCAACCTGTACTTGG - Intergenic
1065746412 10:28846344-28846366 AGGCTTGCACAACCTGCACTGGG - Intergenic
1067509063 10:46880073-46880095 AGGCATACACAACATGCTCTTGG - Intergenic
1067653188 10:48171777-48171799 AGGCATACACAACATGCTCTTGG + Intronic
1069116467 10:64512912-64512934 AGGGATACTTAACCTTCCCTGGG - Intergenic
1070436721 10:76401074-76401096 AGGGATACTCAACCTGTGCTAGG + Intronic
1071112450 10:82175580-82175602 AGGCATCCACAATTTGCTCTGGG + Intronic
1071479106 10:86049757-86049779 AGAAATACATAACCTCCTCTTGG + Intronic
1079268466 11:18958713-18958735 AAGGAGACACACCCTCCTCTAGG + Intergenic
1081538789 11:44015049-44015071 AGGCATGCACAAACTGCTCTGGG + Intergenic
1084137302 11:67194729-67194751 ATAGATCCACAACCTGCTCTTGG + Intronic
1084531510 11:69730558-69730580 TGGGATCCTCGACCTGCTCTTGG - Intergenic
1085277645 11:75310236-75310258 AGGGCAACACAGCCTGCTCCAGG + Intronic
1087196133 11:95305861-95305883 AGGAGAACACATCCTGCTCTGGG + Intergenic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1089893936 11:121908609-121908631 AGTGAGGCTCAACCTGCTCTGGG - Intergenic
1094267363 12:28574242-28574264 AGTGATACCCAACTTGGTCTCGG + Intronic
1094562459 12:31568365-31568387 AGGGATACTCAACCTGTATTGGG + Intronic
1095207969 12:39460123-39460145 AAGGAAACACTAGCTGCTCTTGG + Intergenic
1096236495 12:49931520-49931542 AGGGCTACACAACCTGTATTAGG + Intergenic
1098460504 12:70728131-70728153 AGGGATACTCAACCTGTATTGGG - Intronic
1098460538 12:70728419-70728441 AGGGATACTCAACCTGTACTGGG + Intronic
1100044794 12:90366543-90366565 AGGGCTATACAAACTCCTCTTGG + Intergenic
1102049100 12:109849447-109849469 ACACATACACAGCCTGCTCTGGG + Intergenic
1104186189 12:126434230-126434252 AGGCATACAAAACCTGCTTTAGG - Intergenic
1105213273 13:18270491-18270513 AGAGACCCACACCCTGCTCTCGG + Intergenic
1106158607 13:27180476-27180498 AGGGACACTCAACCTGCAGTAGG + Intergenic
1108324331 13:49315197-49315219 AGGAATACAGAACCCTCTCTGGG + Intronic
1108787705 13:53926202-53926224 AGGGATACACAACTATCTATTGG + Intergenic
1116971456 14:51070669-51070691 AAGAATACTCAACCTGCACTGGG + Intronic
1117813388 14:59572107-59572129 AGGGATGCTCAACCTGCATTTGG + Intronic
1118297002 14:64579667-64579689 AAGGTTAAAAAACCTGCTCTTGG + Intronic
1119899577 14:78248502-78248524 AGGGATAAGCAGCCTCCTCTTGG - Intronic
1123435110 15:20248653-20248675 AGGGACACACACCCAGCTGTCGG + Intergenic
1124055338 15:26236734-26236756 AGGGATACTCAACCTGCATTAGG + Intergenic
1126728916 15:51661634-51661656 TGGGAAACACAACATCCTCTAGG + Intergenic
1126864871 15:52925415-52925437 ATGGATAAACAACCAGCACTGGG + Intergenic
1128180382 15:65597961-65597983 GGGGATACTCAACCTGTACTAGG - Intronic
1128626379 15:69209823-69209845 AGGGATTCACCACATCCTCTTGG + Intronic
1128840959 15:70851805-70851827 AAGGAAACACAGCCAGCTCTGGG + Intronic
1131366127 15:91842697-91842719 AGGGATACTCAACCTTTACTGGG - Intergenic
1131637800 15:94256379-94256401 AGGGATACTCAACCTGTAGTAGG + Intronic
1132308982 15:100842356-100842378 AGGGATACATGACCTGCCCAAGG - Intergenic
1133050147 16:3112842-3112864 TGGGATGCCCATCCTGCTCTCGG - Exonic
1135279211 16:21139455-21139477 AGGGATTCACAACCCTTTCTAGG - Intronic
1135514313 16:23116926-23116948 AGGGATACTCAACCTGTACCAGG - Intronic
1136525256 16:30825499-30825521 AGAGCTATACAACCTGCTCCCGG - Intergenic
1136635553 16:31520251-31520273 AGGGAGACACCAACTGCTCAGGG + Intergenic
1137329588 16:47479013-47479035 AGGAATTCACAACTTGCTCAAGG - Intronic
1138514065 16:57526276-57526298 AGGAAGACACACCCTGCTCTGGG + Intronic
1139157156 16:64457451-64457473 AGGGATACAAAACCTTCTTCAGG - Intergenic
1139167098 16:64580065-64580087 ATGGATAAACAAACTGATCTTGG + Intergenic
1139582534 16:67881908-67881930 AGGAGTACACGACCTGCTCCAGG + Intronic
1140841244 16:78841148-78841170 ACAGATACACAACGTGCACTGGG + Intronic
1144491860 17:15719715-15719737 AGGGACATACAACCTACTATGGG - Exonic
1146701949 17:34968844-34968866 AGGTATACACAACAGCCTCTAGG + Intronic
1147703029 17:42407765-42407787 AGGGATAAACAAAATGCCCTAGG - Intronic
1148125613 17:45235019-45235041 AGGGATTCACAAGATGCTCTAGG - Intronic
1149332323 17:55597004-55597026 AGGGATGCTCAACCTGCAATAGG - Intergenic
1149564833 17:57633692-57633714 AGGGATACATGACTTGCTCAAGG - Intronic
1157433323 18:47648856-47648878 AGGGATAAATCAGCTGCTCTAGG - Intergenic
1157485735 18:48085470-48085492 AGGGATCCAAACCCTGGTCTAGG - Intronic
1157632378 18:49111711-49111733 ATGGATACACACCCTGCTCTGGG - Intronic
1158234453 18:55297812-55297834 AGGGATACTCAAACTGTCCTTGG - Intronic
1158254823 18:55533921-55533943 AGGGATACTTAACCTGTACTGGG - Intronic
1159060193 18:63506499-63506521 ATGGATAGACAACCTACTCAAGG + Intergenic
1159065052 18:63560250-63560272 ATGGAGACACAGCTTGCTCTAGG - Intronic
1159686572 18:71428862-71428884 AGGGATAACAATCCTGCTCTGGG - Intergenic
1161231503 19:3177093-3177115 GGGGAGACACACCCTGCCCTGGG - Intronic
1162179757 19:8860138-8860160 AGGAACACACAACCTTGTCTTGG - Intronic
1164233852 19:23315119-23315141 AGAGTTACACCACCTGCTTTAGG - Intronic
1164729288 19:30490384-30490406 AAGGATACACAACCCCCTCCTGG - Intronic
1164773536 19:30832156-30832178 AGGAATAGACAAGCTGATCTTGG - Intergenic
1167011879 19:46813835-46813857 AGCGAGACACAACCTCCTCCAGG + Intergenic
1168523033 19:57067807-57067829 ATGATTACACAACCTACTCTGGG - Intergenic
926496103 2:13590524-13590546 AGAGTTAAACAACCTGCTCCTGG - Intergenic
927477613 2:23425934-23425956 ATGTATACACAGCATGCTCTTGG - Intronic
927494959 2:23546028-23546050 AGGGAGACACCATCTGCTCTTGG - Intronic
927978155 2:27356193-27356215 AGGGAAACACAACTGGCCCTTGG + Exonic
928767719 2:34667850-34667872 AGGGACAGAAAACCTGTTCTGGG - Intergenic
933795418 2:85915509-85915531 AGCGATTCTCAAGCTGCTCTGGG + Intergenic
934301048 2:91776253-91776275 AGAGACCCACACCCTGCTCTCGG - Intergenic
935091532 2:99899473-99899495 AGGGATAAATAAACTGCTCCTGG + Intronic
935153599 2:100462226-100462248 AGGGATACTAATCCTGCTCATGG + Intergenic
935678596 2:105617283-105617305 AGTGATTCACAGACTGCTCTGGG - Intergenic
938314065 2:130314550-130314572 AGGGAGGCACATCCTTCTCTGGG - Intergenic
938682413 2:133705146-133705168 GGGGATACACCTCCTGCACTTGG - Intergenic
939769122 2:146292575-146292597 ATGGAAACACAAACTGCTCGTGG - Intergenic
944336989 2:198545660-198545682 AGTGTTACACAAACTGCTCGAGG - Intronic
946225544 2:218262298-218262320 AGGGATACACAAAATGCTTTGGG + Exonic
947880212 2:233502318-233502340 AGGGATACTCAACCTGTAATTGG - Intronic
948450129 2:238064201-238064223 AGGCATCCACAAGCTGCACTTGG - Intronic
1169004844 20:2198053-2198075 AGAGATTCACAACCTCCTCCAGG + Intergenic
1172495553 20:35380984-35381006 TGGGATGCTCAACCTGTTCTAGG + Intronic
1173046613 20:39518700-39518722 AGGTGTACAGAACCTGCTCTGGG - Intergenic
1175424781 20:58856295-58856317 GGGGAAACACAACCTGCTGTAGG + Intronic
1175546483 20:59781359-59781381 TGGGTTACCCAACCTGGTCTGGG - Intronic
1175789883 20:61734633-61734655 AGGGAAACTCAACCTGCTGAAGG - Intronic
1178964046 21:37098481-37098503 ATAGATCCACAAGCTGCTCTTGG - Intronic
1179788014 21:43740729-43740751 AGGTGTATACAACCTGCCCTTGG - Intronic
1180816101 22:18790891-18790913 AGAGACCCACACCCTGCTCTCGG + Intergenic
1181202288 22:21225223-21225245 AGAGACCCACACCCTGCTCTCGG + Intronic
1181555633 22:23670323-23670345 AGAGACCCACACCCTGCTCTCGG + Intergenic
1181699413 22:24611391-24611413 AGAGACCCACACCCTGCTCTCGG - Intronic
1183482208 22:38071441-38071463 AGGGGTACACAGCCTGCTGTGGG - Intronic
1185087945 22:48750698-48750720 CGGGAGACCCAACATGCTCTTGG - Exonic
1203224622 22_KI270731v1_random:70190-70212 AGAGACCCACACCCTGCTCTCGG - Intergenic
1203266204 22_KI270734v1_random:16602-16624 AGAGACCCACACCCTGCTCTCGG + Intergenic
951548694 3:23855217-23855239 ACAAATACACAACCTTCTCTAGG + Intronic
953936135 3:47045043-47045065 AGGGATACTCAACCTGTACGCGG + Intronic
956141537 3:66151381-66151403 AGTGAGACACAACCTGAGCTGGG - Intronic
960151243 3:114251054-114251076 AAGGTTAGACAACTTGCTCTAGG - Intergenic
965396387 3:168164702-168164724 AGTGATACTCAACCTGCATTAGG + Intergenic
967060523 3:185868356-185868378 AGGGATACAGAAGCTGCTGTGGG - Intergenic
967234414 3:187370328-187370350 AAGGATACGCAACCTGCTTAAGG - Intronic
968569045 4:1329767-1329789 AGTGATACACAACACCCTCTGGG - Intronic
968921587 4:3524868-3524890 AGGGATACTCGACCTGCATTAGG + Intronic
969670660 4:8588290-8588312 AGGGATGCTCCACCTTCTCTTGG - Intronic
974700137 4:65432789-65432811 AATAAGACACAACCTGCTCTAGG - Intronic
975770853 4:77720821-77720843 AGGGAAACACAGCATGCTATTGG + Intronic
980653656 4:135754287-135754309 AGAGATACAGAACTTACTCTGGG + Intergenic
984878494 4:184390248-184390270 TGGGGCACACAACCAGCTCTGGG + Intronic
988972194 5:36480261-36480283 AGGGAAAAACAATCAGCTCTTGG - Intergenic
992067897 5:73124064-73124086 AGGGTTTCACCAGCTGCTCTTGG + Intronic
993274910 5:85844340-85844362 AGGGATACTCAACCTGGACTAGG + Intergenic
995104131 5:108353907-108353929 AGGGATACGCAACCTATACTGGG - Intronic
996014512 5:118518133-118518155 AGGGATGCTCAACCTGTACTAGG - Intergenic
997946397 5:138205982-138206004 AGGGATACTCAACCTGTACTAGG + Intronic
998384410 5:141748187-141748209 AGGGATGTACAAAGTGCTCTGGG - Intergenic
999219908 5:149966540-149966562 AGGGATACTCAACCTGTACTGGG - Intronic
999672418 5:153969259-153969281 AGGGAATCAGAACCTACTCTTGG - Intergenic
999971629 5:156869520-156869542 TAAGATACATAACCTGCTCTAGG + Intergenic
1001525905 5:172428707-172428729 AAGTATACACAATCTGCTGTTGG + Intronic
1001998447 5:176181002-176181024 AGGGACACACAGCCTGCCCTGGG - Intergenic
1002189760 5:177472493-177472515 GGGGATGGACCACCTGCTCTGGG - Intronic
1003614706 6:7644639-7644661 AGGGATAGAGATCCTGGTCTGGG + Intergenic
1004492320 6:16128924-16128946 AGGGAAACTCAGCCGGCTCTGGG + Intergenic
1012503143 6:99913039-99913061 AGAGAAACCCAACCTGCACTGGG - Intergenic
1013284842 6:108672264-108672286 AGCGATAAACCACCAGCTCTGGG - Intronic
1017759025 6:157553650-157553672 GGGGAAATACAGCCTGCTCTGGG + Intronic
1020559473 7:9712948-9712970 AGGGAAAAATAACCTGCCCTAGG + Intergenic
1022049435 7:26651359-26651381 AGGTATACACAATCTCCTCTTGG - Intergenic
1023387670 7:39676392-39676414 AAGGATACATAACCTGTTTTAGG - Intronic
1023474926 7:40566713-40566735 AAGCATCCACAACCTGCTCACGG - Intronic
1026987975 7:74566845-74566867 AGGGACACACAACAAGCCCTAGG - Intronic
1031447769 7:121875018-121875040 AGAGATCCGCAACATGCTCTGGG - Intronic
1031521453 7:122771144-122771166 AGGGAAACATAACCTGCAGTAGG + Intronic
1032210844 7:129912700-129912722 AGGGATGCACAACCTGTTTTTGG + Intronic
1036993005 8:13620484-13620506 AGTGATACACATCCACCTCTTGG - Intergenic
1037384007 8:18318191-18318213 ATGAATTCACAAGCTGCTCTTGG - Intergenic
1038913948 8:31998994-31999016 AAGTATACCCAACCTGCTTTGGG - Intronic
1044792828 8:95865134-95865156 AGGGAGACACAACCTGGAGTGGG + Intergenic
1045201497 8:99986994-99987016 AGGGATACTCAACCTGTATTAGG - Intronic
1046722897 8:117640745-117640767 AGGGGTACACAGCCTGCTACGGG - Intergenic
1047679953 8:127244466-127244488 GGGCACACACAACCTGTTCTGGG - Intergenic
1048243175 8:132764714-132764736 TGGGATCCATAACCTGGTCTGGG - Intergenic
1049009251 8:139876339-139876361 TGGGATCCACAGCCTGCTCCAGG + Intronic
1051115169 9:13686169-13686191 AGGGCTGCACAAAGTGCTCTGGG + Intergenic
1051357149 9:16250101-16250123 AAGGATCCACAATCTCCTCTGGG - Intronic
1051509531 9:17862073-17862095 AGGAAAACACAATCTGCTCTTGG - Intergenic
1051509768 9:17864513-17864535 AGGGATCCATAATCTGCTCCTGG + Intergenic
1053334593 9:37254867-37254889 AGGGATACTCAACCTGTTCTTGG + Intronic
1053668109 9:40331385-40331407 AGGGATACACAACATGCCATTGG + Intergenic
1053917914 9:42957680-42957702 AGGGATACACAACATGCCATTGG + Intergenic
1054379252 9:64471441-64471463 AGGGATACACAACATGCCATTGG + Intergenic
1054516502 9:66044908-66044930 AGGGATACACAACATGCCATTGG - Intergenic
1055907844 9:81314598-81314620 AGGGATACACAGCCTGCTTGTGG + Intergenic
1059575293 9:115481610-115481632 AGGGATCCAGAATCTGCCCTAGG - Intergenic
1060387727 9:123248017-123248039 AGGTATACACAAGGTGCTTTAGG + Intronic
1062526674 9:136980623-136980645 AGGGGTGGACAGCCTGCTCTTGG + Intronic
1186586496 X:10879404-10879426 AGGGAGACACAATTTGATCTTGG - Intergenic
1188004574 X:25008202-25008224 AGGGATACACAACCTGCTCTTGG + Intronic
1188026842 X:25218765-25218787 AGGGAAACACAAAATGCACTTGG + Intergenic
1189296506 X:39922016-39922038 AGGGACACATGACCAGCTCTTGG + Intergenic
1192141556 X:68650860-68650882 AGAGATCCTCAACCTTCTCTTGG - Intronic
1194640179 X:96394600-96394622 ATAGATACACAACCTGACCTTGG - Intergenic
1197660298 X:129163288-129163310 AGGGATACTCAATCTGCACATGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198792675 X:140362617-140362639 AGTGATACACAAAGTGCTGTTGG - Intergenic
1199694878 X:150336854-150336876 TGGGAAGCACAACTTGCTCTAGG - Intergenic