ID: 1188005364

View in Genome Browser
Species Human (GRCh38)
Location X:25012932-25012954
Sequence CGTCCGGGTAGTGCGTCTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 14}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188005356_1188005364 10 Left 1188005356 X:25012899-25012921 CCGCGACCACCCTACGCGCATAC 0: 1
1: 0
2: 0
3: 3
4: 24
Right 1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG 0: 1
1: 0
2: 1
3: 1
4: 14
1188005358_1188005364 4 Left 1188005358 X:25012905-25012927 CCACCCTACGCGCATACCTGGTG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG 0: 1
1: 0
2: 1
3: 1
4: 14
1188005359_1188005364 1 Left 1188005359 X:25012908-25012930 CCCTACGCGCATACCTGGTGAAG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG 0: 1
1: 0
2: 1
3: 1
4: 14
1188005355_1188005364 19 Left 1188005355 X:25012890-25012912 CCGCTGCGACCGCGACCACCCTA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG 0: 1
1: 0
2: 1
3: 1
4: 14
1188005360_1188005364 0 Left 1188005360 X:25012909-25012931 CCTACGCGCATACCTGGTGAAGA 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG 0: 1
1: 0
2: 1
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188005364 Original CRISPR CGTCCGGGTAGTGCGTCTTC TGG Exonic
906528559 1:46510576-46510598 CATCTGGGTAGTGAGTCTTCTGG - Exonic
1075122199 10:119672431-119672453 GCGCTGGGTAGTGCGTCTTCTGG - Exonic
1076828726 10:132983395-132983417 CCTCAGGGCAGTGGGTCTTCAGG + Intergenic
1081568505 11:44275404-44275426 CGTCTGGGTAGTGGGTCTTCTGG + Exonic
1084944814 11:72632815-72632837 CCTCCGGGCAGTGCCTCTGCTGG - Intronic
1093462434 12:19418996-19419018 TGTCCGGCTAGTGGCTCTTCAGG + Intronic
1121546804 14:94769014-94769036 CGTCCGGGTACTTGGTCTCCTGG + Exonic
1125843387 15:42827166-42827188 CTTCAGGGTGGTGCGTCTTTGGG - Intronic
1149508465 17:57216214-57216236 GGTCCGGGTAGTGCTCCTGCAGG - Intergenic
1154173705 18:12068118-12068140 ACTCCTGGTGGTGCGTCTTCTGG - Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
948310723 2:236983929-236983951 AGTCAGGGCAGTGGGTCTTCTGG - Intergenic
968296149 3:197577849-197577871 CCTCCAGGTAATGTGTCTTCAGG + Intergenic
972664874 4:41155589-41155611 TGTCTGGGTAGTGTGTCTTTCGG - Intronic
1047710840 8:127550736-127550758 CTGCAGGGTAGTGCGTCATCAGG - Intergenic
1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG + Exonic