ID: 1188006518

View in Genome Browser
Species Human (GRCh38)
Location X:25019827-25019849
Sequence CCGGTGCTGGGAAGAGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188006510_1188006518 10 Left 1188006510 X:25019794-25019816 CCTTGTGAGGATAACAAGCGTCG No data
Right 1188006518 X:25019827-25019849 CCGGTGCTGGGAAGAGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188006518 Original CRISPR CCGGTGCTGGGAAGAGCCGG AGG Intergenic
No off target data available for this crispr