ID: 1188007071

View in Genome Browser
Species Human (GRCh38)
Location X:25022836-25022858
Sequence AGAAGAGGAGGTGACGCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188007071_1188007089 29 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007089 X:25022888-25022910 AGGGCACCGCTTGCCCGAGGCGG No data
1188007071_1188007078 -2 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007078 X:25022857-25022879 CTAACCGGTCACCCCGGGCAGGG No data
1188007071_1188007076 -7 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007076 X:25022852-25022874 CTCTTCTAACCGGTCACCCCGGG No data
1188007071_1188007075 -8 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007075 X:25022851-25022873 CCTCTTCTAACCGGTCACCCCGG No data
1188007071_1188007088 26 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007088 X:25022885-25022907 CTCAGGGCACCGCTTGCCCGAGG No data
1188007071_1188007077 -3 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007077 X:25022856-25022878 TCTAACCGGTCACCCCGGGCAGG No data
1188007071_1188007083 10 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007083 X:25022869-25022891 CCCGGGCAGGGCCCTCCTCAGGG No data
1188007071_1188007081 9 Left 1188007071 X:25022836-25022858 CCGACGGCGTCACCTCCTCTTCT No data
Right 1188007081 X:25022868-25022890 CCCCGGGCAGGGCCCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188007071 Original CRISPR AGAAGAGGAGGTGACGCCGT CGG (reversed) Intergenic