ID: 1188009536

View in Genome Browser
Species Human (GRCh38)
Location X:25041592-25041614
Sequence ATGGAGACACAGAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188009536_1188009543 5 Left 1188009536 X:25041592-25041614 CCATCCTCTCTCTGTGTCTCCAT No data
Right 1188009543 X:25041620-25041642 GTTAGGTGGAGAGGATTTCATGG No data
1188009536_1188009541 -4 Left 1188009536 X:25041592-25041614 CCATCCTCTCTCTGTGTCTCCAT No data
Right 1188009541 X:25041611-25041633 CCATCCATAGTTAGGTGGAGAGG No data
1188009536_1188009539 -9 Left 1188009536 X:25041592-25041614 CCATCCTCTCTCTGTGTCTCCAT No data
Right 1188009539 X:25041606-25041628 TGTCTCCATCCATAGTTAGGTGG No data
1188009536_1188009544 17 Left 1188009536 X:25041592-25041614 CCATCCTCTCTCTGTGTCTCCAT No data
Right 1188009544 X:25041632-25041654 GGATTTCATGGACCTAGAGAAGG No data
1188009536_1188009545 18 Left 1188009536 X:25041592-25041614 CCATCCTCTCTCTGTGTCTCCAT No data
Right 1188009545 X:25041633-25041655 GATTTCATGGACCTAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188009536 Original CRISPR ATGGAGACACAGAGAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr