ID: 1188012742

View in Genome Browser
Species Human (GRCh38)
Location X:25074990-25075012
Sequence AGAAATCCTTTGGGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188012742_1188012750 26 Left 1188012742 X:25074990-25075012 CCTTTCTCCCCCAAAGGATTTCT No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data
1188012742_1188012749 -4 Left 1188012742 X:25074990-25075012 CCTTTCTCCCCCAAAGGATTTCT No data
Right 1188012749 X:25075009-25075031 TTCTGTTAGTCATTAGAGGGAGG No data
1188012742_1188012747 -8 Left 1188012742 X:25074990-25075012 CCTTTCTCCCCCAAAGGATTTCT No data
Right 1188012747 X:25075005-25075027 GGATTTCTGTTAGTCATTAGAGG No data
1188012742_1188012751 27 Left 1188012742 X:25074990-25075012 CCTTTCTCCCCCAAAGGATTTCT No data
Right 1188012751 X:25075040-25075062 TGCTCATGAACCACTGTGCAGGG No data
1188012742_1188012748 -7 Left 1188012742 X:25074990-25075012 CCTTTCTCCCCCAAAGGATTTCT No data
Right 1188012748 X:25075006-25075028 GATTTCTGTTAGTCATTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188012742 Original CRISPR AGAAATCCTTTGGGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr