ID: 1188012744

View in Genome Browser
Species Human (GRCh38)
Location X:25074998-25075020
Sequence TGACTAACAGAAATCCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188012744_1188012751 19 Left 1188012744 X:25074998-25075020 CCCCAAAGGATTTCTGTTAGTCA No data
Right 1188012751 X:25075040-25075062 TGCTCATGAACCACTGTGCAGGG No data
1188012744_1188012750 18 Left 1188012744 X:25074998-25075020 CCCCAAAGGATTTCTGTTAGTCA No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188012744 Original CRISPR TGACTAACAGAAATCCTTTG GGG (reversed) Intergenic
No off target data available for this crispr