ID: 1188012750

View in Genome Browser
Species Human (GRCh38)
Location X:25075039-25075061
Sequence GTGCTCATGAACCACTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188012746_1188012750 16 Left 1188012746 X:25075000-25075022 CCAAAGGATTTCTGTTAGTCATT No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data
1188012743_1188012750 19 Left 1188012743 X:25074997-25075019 CCCCCAAAGGATTTCTGTTAGTC No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data
1188012745_1188012750 17 Left 1188012745 X:25074999-25075021 CCCAAAGGATTTCTGTTAGTCAT No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data
1188012742_1188012750 26 Left 1188012742 X:25074990-25075012 CCTTTCTCCCCCAAAGGATTTCT No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data
1188012744_1188012750 18 Left 1188012744 X:25074998-25075020 CCCCAAAGGATTTCTGTTAGTCA No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data
1188012741_1188012750 27 Left 1188012741 X:25074989-25075011 CCCTTTCTCCCCCAAAGGATTTC No data
Right 1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188012750 Original CRISPR GTGCTCATGAACCACTGTGC AGG Intergenic
No off target data available for this crispr