ID: 1188013687

View in Genome Browser
Species Human (GRCh38)
Location X:25084702-25084724
Sequence GGGTGTTAACAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188013687_1188013690 -9 Left 1188013687 X:25084702-25084724 CCTGCCTCCATCTGTTAACACCC No data
Right 1188013690 X:25084716-25084738 TTAACACCCAGTTTGAACTGCGG No data
1188013687_1188013694 28 Left 1188013687 X:25084702-25084724 CCTGCCTCCATCTGTTAACACCC No data
Right 1188013694 X:25084753-25084775 GTGTGGCCTTCATTTTAATTAGG No data
1188013687_1188013693 11 Left 1188013687 X:25084702-25084724 CCTGCCTCCATCTGTTAACACCC No data
Right 1188013693 X:25084736-25084758 CGGTATTATATTTTCTAGTGTGG No data
1188013687_1188013695 29 Left 1188013687 X:25084702-25084724 CCTGCCTCCATCTGTTAACACCC No data
Right 1188013695 X:25084754-25084776 TGTGGCCTTCATTTTAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188013687 Original CRISPR GGGTGTTAACAGATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr