ID: 1188016494

View in Genome Browser
Species Human (GRCh38)
Location X:25112744-25112766
Sequence TAGTGGCTAAGATGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188016494_1188016500 24 Left 1188016494 X:25112744-25112766 CCATCCTCCCATCTTAGCCACTA No data
Right 1188016500 X:25112791-25112813 TCTAGAGACAGCGTTCTCCCTGG No data
1188016494_1188016501 25 Left 1188016494 X:25112744-25112766 CCATCCTCCCATCTTAGCCACTA No data
Right 1188016501 X:25112792-25112814 CTAGAGACAGCGTTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188016494 Original CRISPR TAGTGGCTAAGATGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr