ID: 1188016513

View in Genome Browser
Species Human (GRCh38)
Location X:25112853-25112875
Sequence CTGTGGGAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188016513_1188016519 -8 Left 1188016513 X:25112853-25112875 CCTTCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1188016519 X:25112868-25112890 TCCCACAGTGTCGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188016513 Original CRISPR CTGTGGGAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr