ID: 1188018392

View in Genome Browser
Species Human (GRCh38)
Location X:25129686-25129708
Sequence AGAGCAGTAGCCTGTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188018390_1188018392 8 Left 1188018390 X:25129655-25129677 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1188018392 X:25129686-25129708 AGAGCAGTAGCCTGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188018392 Original CRISPR AGAGCAGTAGCCTGTTTTGG TGG Intergenic
No off target data available for this crispr