ID: 1188020864

View in Genome Browser
Species Human (GRCh38)
Location X:25155952-25155974
Sequence CTGTGAGAATATAATAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188020864_1188020866 -3 Left 1188020864 X:25155952-25155974 CCTAGTCTATTATATTCTCACAG No data
Right 1188020866 X:25155972-25155994 CAGCATCCAGTGAGGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188020864 Original CRISPR CTGTGAGAATATAATAGACT AGG (reversed) Intergenic
No off target data available for this crispr