ID: 1188027679

View in Genome Browser
Species Human (GRCh38)
Location X:25227555-25227577
Sequence CAAAATATGAAACTCCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188027675_1188027679 29 Left 1188027675 X:25227503-25227525 CCATATAAAAAAAATCAAATCAA No data
Right 1188027679 X:25227555-25227577 CAAAATATGAAACTCCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188027679 Original CRISPR CAAAATATGAAACTCCTACA AGG Intergenic
No off target data available for this crispr