ID: 1188039769

View in Genome Browser
Species Human (GRCh38)
Location X:25358216-25358238
Sequence ATGAAGAGGCAGAGTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188039769_1188039773 12 Left 1188039769 X:25358216-25358238 CCTTGCTCACTCTGCCTCTTCAT No data
Right 1188039773 X:25358251-25358273 AATCTGGCATATTTCAAACTTGG No data
1188039769_1188039771 -4 Left 1188039769 X:25358216-25358238 CCTTGCTCACTCTGCCTCTTCAT No data
Right 1188039771 X:25358235-25358257 TCATTCTTTTACCAAAAATCTGG No data
1188039769_1188039774 13 Left 1188039769 X:25358216-25358238 CCTTGCTCACTCTGCCTCTTCAT No data
Right 1188039774 X:25358252-25358274 ATCTGGCATATTTCAAACTTGGG No data
1188039769_1188039775 14 Left 1188039769 X:25358216-25358238 CCTTGCTCACTCTGCCTCTTCAT No data
Right 1188039775 X:25358253-25358275 TCTGGCATATTTCAAACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188039769 Original CRISPR ATGAAGAGGCAGAGTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr