ID: 1188041044

View in Genome Browser
Species Human (GRCh38)
Location X:25369924-25369946
Sequence CAGTAGGACTCCAGGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188041034_1188041044 21 Left 1188041034 X:25369880-25369902 CCTGGCAACAGCAGCCAGCAGTG No data
Right 1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG No data
1188041035_1188041044 7 Left 1188041035 X:25369894-25369916 CCAGCAGTGATACCTGCATGTGG No data
Right 1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG No data
1188041038_1188041044 -5 Left 1188041038 X:25369906-25369928 CCTGCATGTGGGCAATGCCAGTA No data
Right 1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG No data
1188041033_1188041044 22 Left 1188041033 X:25369879-25369901 CCCTGGCAACAGCAGCCAGCAGT No data
Right 1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188041044 Original CRISPR CAGTAGGACTCCAGGGATGT GGG Intergenic
No off target data available for this crispr