ID: 1188052760

View in Genome Browser
Species Human (GRCh38)
Location X:25507973-25507995
Sequence TTAACGATTTTGTTGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188052755_1188052760 30 Left 1188052755 X:25507920-25507942 CCTGAGTTTTGTCACAAGGCAAG No data
Right 1188052760 X:25507973-25507995 TTAACGATTTTGTTGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188052760 Original CRISPR TTAACGATTTTGTTGCTGAT GGG Intergenic
No off target data available for this crispr