ID: 1188053064

View in Genome Browser
Species Human (GRCh38)
Location X:25510192-25510214
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 3, 1: 19, 2: 68, 3: 120, 4: 458}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188053064_1188053065 4 Left 1188053064 X:25510192-25510214 CCATTATCATTATCAGCATTTTG 0: 3
1: 19
2: 68
3: 120
4: 458
Right 1188053065 X:25510219-25510241 AAACCATTCAACAAGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188053064 Original CRISPR CAAAATGCTGATAATGATAA TGG (reversed) Intergenic
900805800 1:4767530-4767552 AAAGATGGTGATGATGATAATGG - Intronic
900805807 1:4767596-4767618 AAAGATGGTGATGATGATAATGG - Intronic
900894316 1:5472808-5472830 TAAAATGGGGATAATGACAAAGG - Intergenic
900941703 1:5802871-5802893 GATGATGCTGATGATGATAATGG - Intergenic
902226996 1:15002602-15002624 CAAGATGATGACAATGATGATGG - Intronic
902490959 1:16780175-16780197 CACAATGATGCTAATGATGATGG - Intronic
902556819 1:17251780-17251802 TAAACTGATGATGATGATAATGG - Intronic
902658158 1:17883672-17883694 TACAATGGGGATAATGATAAAGG + Intergenic
903083966 1:20838334-20838356 GAAAATTCTGGAAATGATAATGG - Intronic
903421830 1:23223342-23223364 TAAAATAATGATAATAATAATGG - Intergenic
903434561 1:23336900-23336922 TAAAATGGTAATAATAATAATGG + Intronic
903748861 1:25606653-25606675 GAAAATGAGGATAATGATACTGG - Intergenic
903801184 1:25969566-25969588 TAAAATGCAGTTAATAATAAAGG + Intronic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
905996368 1:42384440-42384462 CAGAATGCACATAATAATAATGG + Intronic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909020135 1:70421952-70421974 CAAAATGGAGATAATTATACCGG + Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909563661 1:77031906-77031928 CAATATGATGAGAATTATAAAGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909900948 1:81134581-81134603 CAAAATACTGATTAATATAAAGG - Intergenic
909941132 1:81613289-81613311 CAACAAGTTGACAATGATAATGG - Intronic
910729175 1:90372291-90372313 CAGAATGTTGATAAAGAAAAAGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911431418 1:97792636-97792658 TAAAGTGGAGATAATGATAATGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
914883848 1:151569187-151569209 CCAAAAGCTGAGAATGGTAAAGG + Intronic
915087982 1:153401275-153401297 CAAAATTCTGATAAACATTAAGG - Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
915773947 1:158461977-158461999 CCAAATTCTGAGAATTATAAAGG - Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917608834 1:176665514-176665536 CAAAGTACTGATGAGGATAAGGG - Intronic
917745251 1:178000519-178000541 TAAAATGATGATAATAGTAATGG - Intergenic
917771536 1:178285009-178285031 AAAAATGCTGAGAAAGAGAAGGG - Intronic
917846203 1:179022616-179022638 GAAAATGCTTACAATGATGAAGG + Intergenic
917864859 1:179184636-179184658 GAAGATGATGATGATGATAAAGG + Intronic
917973720 1:180225296-180225318 CAAAATGCAAATAATGAAAGGGG + Intergenic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
918568562 1:185959658-185959680 GATAATGGTGATAATGATGATGG + Intronic
919122414 1:193357674-193357696 CAAAATGCCTAGAATTATAATGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920723570 1:208412741-208412763 AAAAATGATGATGATGATAGTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921187270 1:212681122-212681144 CAATAGGTTGATGATGATAATGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921553715 1:216570571-216570593 CAAAATTCTTATAATGAAAGAGG - Intronic
921653778 1:217709761-217709783 CAAAATGCTGAAAATCAACATGG - Intronic
921705789 1:218322010-218322032 CAAAATGCTGAATATGCTTAAGG - Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922563129 1:226583433-226583455 CAGATTGATTATAATGATAATGG + Intronic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923073201 1:230584629-230584651 AAAAATGATGATAAAGAGAATGG + Intergenic
923199958 1:231702003-231702025 GAGAATGATGATTATGATAAAGG + Exonic
923346074 1:233053829-233053851 CAAAATAATAATAATGAGAATGG - Intronic
923529487 1:234802359-234802381 CACAATGATGCTAATGATGATGG + Intergenic
923952120 1:238968042-238968064 AAAAGTGCTGATAAAGAAAAAGG + Intergenic
924148213 1:241099551-241099573 CAAATTGCTGGTAATTCTAAAGG + Intronic
1062868127 10:874841-874863 CATAATGATTATGATGATAATGG + Intronic
1062954007 10:1528467-1528489 CAAAGTACTGCTGATGATAATGG + Intronic
1063110239 10:3029294-3029316 CAAAATGTTGAAAATGTTACTGG + Intergenic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1065164290 10:22958718-22958740 CGAAATAATAATAATGATAATGG - Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1068501309 10:57842207-57842229 CAAAATAAAGATAATAATAATGG - Intergenic
1068817006 10:61327926-61327948 CAAGATGGAGATATTGATAATGG - Intergenic
1069338810 10:67386743-67386765 TGAAATACTGAGAATGATAAAGG + Intronic
1070255486 10:74810093-74810115 CAAAATGTTGATAATGTTTGCGG + Intergenic
1071208013 10:83306052-83306074 TAATATGTTGATGATGATAATGG - Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072185944 10:93039156-93039178 CAAAAGGCTGATATTGCTGAAGG + Intronic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1075151548 10:119937227-119937249 AAAAATACTTATAATGACAAAGG - Intronic
1075897710 10:126011920-126011942 CAAAATGCTAACAAGAATAAAGG - Intergenic
1077552444 11:3206779-3206801 GATAATGGTGATGATGATAATGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077872582 11:6274638-6274660 AAACATAATGATAATGATAATGG + Intergenic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1077920315 11:6637095-6637117 CAGAATGGTGATAATGGTGATGG - Intronic
1078343498 11:10520959-10520981 TACAATGCTGACATTGATAATGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079154564 11:17932917-17932939 AAAAGTGCTCATGATGATAAAGG + Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080257553 11:30307876-30307898 CATAATTCTCATGATGATAAAGG + Intergenic
1080346099 11:31327553-31327575 CATAATGATAATAACGATAATGG - Intronic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081830668 11:46110221-46110243 TAAAATGGGGATAATAATAAGGG - Intronic
1082018126 11:47508018-47508040 TTAAATGGTCATAATGATAAAGG - Intronic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082225222 11:49698077-49698099 AAAAATAATGATAATAATAATGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084443398 11:69189249-69189271 GGTAATGATGATAATGATAATGG - Intergenic
1085695477 11:78701041-78701063 CAAAATGGTTAAAATGAAAAGGG + Intronic
1086345156 11:85889039-85889061 CAAACTTCTGATCAAGATAATGG - Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088604813 11:111518504-111518526 CCAAATGGTGATAATCATAATGG - Intronic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1089381968 11:118039709-118039731 CAAAATAATAATAATAATAATGG + Intergenic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090524577 11:127518711-127518733 CATGATGCTGATGATGAGAAAGG - Intergenic
1092167560 12:6352235-6352257 CAAAATAATAATAATAATAATGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092766132 12:11854626-11854648 CAAAATGCTGATCATTGTGAAGG - Intronic
1093567948 12:20631109-20631131 AAAAATGCCGGTAAAGATAAAGG - Intronic
1093668026 12:21837875-21837897 CAAAATGCTAACTATAATAAAGG - Intronic
1093819613 12:23597629-23597651 GGAAGTGATGATAATGATAATGG + Intronic
1093874497 12:24333428-24333450 CAAAATGCAGATAAACTTAACGG + Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095610141 12:44118450-44118472 TCAACTGCTGAAAATGATAAAGG + Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097346310 12:58497223-58497245 AAAAATGATAATAATAATAACGG + Intergenic
1097451813 12:59745396-59745418 TACAATGATGATAATGACAATGG + Intronic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097841068 12:64321815-64321837 CAAACTGCTGAAAATAATAAAGG - Intronic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1098896949 12:76073940-76073962 GAAAATGCTGAGCATGATAATGG - Intronic
1098938677 12:76509662-76509684 AAAAATGATGATGATAATAATGG + Intronic
1099065137 12:77967200-77967222 CAATAGGCTGATATTAATAAAGG - Intronic
1099261075 12:80383549-80383571 CATAATATTGATGATGATAAAGG - Intergenic
1099383139 12:81980232-81980254 AAAATTCCTGATCATGATAATGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099875458 12:88399675-88399697 AAACATGATGATGATGATAAAGG - Intergenic
1101035309 12:100700005-100700027 AAAAATAATAATAATGATAATGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101281840 12:103265624-103265646 CAAGATGCTGAAAATGTTCATGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1102436697 12:112929793-112929815 CAAGAAGATGATAATGATGATGG + Intronic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1103985444 12:124764201-124764223 CAAAATAATAATAATAATAATGG + Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107708301 13:43128523-43128545 AAAAATGGAGATAATAATAATGG - Intergenic
1108977018 13:56458705-56458727 CTCAATGATGATAATGATAATGG + Intergenic
1109182470 13:59230408-59230430 TAAAATGGGGAGAATGATAACGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109438721 13:62341352-62341374 CAAAATGCTAAGATTGATCACGG - Intergenic
1109451463 13:62520066-62520088 CAAAATGCTGAGAAAGAAAATGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110381398 13:74855685-74855707 GACAATGGTGATAATGATAATGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1110842624 13:80159771-80159793 AAAAATTCTGATCATGAAAATGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111459346 13:88519394-88519416 CAAGTTGCTGATAATGACACGGG + Intergenic
1111957268 13:94773349-94773371 CAAAATTATGATCAGGATAACGG - Intergenic
1112423415 13:99274626-99274648 CATAATACTGTTAATGTTAATGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112893166 13:104264056-104264078 TAAATTTCTGCTAATGATAATGG - Intergenic
1113233538 13:108242135-108242157 CAAAATGCTGCTGATGATCGAGG - Intergenic
1113615013 13:111674138-111674160 GAAGATGCTAATAATAATAATGG + Intergenic
1113620482 13:111759052-111759074 GAAGATGCTAATAATAATAATGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115042987 14:28954801-28954823 CATAATACTTATAATGATAATGG + Intergenic
1115533355 14:34346783-34346805 CAAAATGATGGTAATGAGAGTGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116487284 14:45465572-45465594 CAAGATACTGATAAGGCTAATGG + Intergenic
1116618500 14:47168794-47168816 TAAAATGCTAATAAGGCTAATGG + Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1118042252 14:61930116-61930138 CAAGATGCTTATATTCATAAAGG + Intergenic
1118399272 14:65364542-65364564 AAGAATGCTGAGAACGATAAGGG - Intergenic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120499345 14:85275201-85275223 CAAAAAGCTCAAAATGAAAAAGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120790678 14:88578547-88578569 CAAAATTCTGATAATAACTAAGG - Intronic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1121199248 14:92104062-92104084 CAAGTTGATGATAATGGTAAAGG + Intronic
1121841005 14:97133785-97133807 CACAATGATGACAATGACAATGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123189280 14:106552427-106552449 GGAAATGCTCATAATGATCAAGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1123976640 15:25559948-25559970 CAAATTGCTGATAAGGACCAAGG - Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124713686 15:32036574-32036596 CCAAATGCTGACATGGATAAAGG - Intronic
1124801217 15:32834654-32834676 AAAATTGCTGAAAATAATAACGG - Intronic
1125377814 15:39051810-39051832 CAAAAAACTGAAAATGAGAAGGG + Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1125790635 15:42363014-42363036 GATAATGATAATAATGATAAAGG + Intronic
1126000993 15:44209795-44209817 AAAGATGATGATAATGACAATGG - Intergenic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126888219 15:53175371-53175393 AAAAATAATGATGATGATAATGG + Intergenic
1127590337 15:60416094-60416116 AAAAATGCCGATAATGGGAAAGG - Intergenic
1127696468 15:61452891-61452913 CATGATGGTGATGATGATAATGG - Intergenic
1128575496 15:68771731-68771753 GACATTGCTGAGAATGATAATGG - Intergenic
1130634794 15:85607481-85607503 CAAAATGGGGATAAAAATAAAGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131368319 15:91858408-91858430 CAAAATGTTAATAATTATTAAGG + Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1131702403 15:94952641-94952663 CAAAAAACTGCTAATTATAAAGG - Intergenic
1131707891 15:95018177-95018199 CAGAATGCTGATCTTGCTAATGG - Intergenic
1133430298 16:5731143-5731165 GAAGATGATGGTAATGATAATGG - Intergenic
1133987464 16:10679482-10679504 AACAATGATGATAATGATGATGG - Intronic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1134808143 16:17143225-17143247 GAAAATGGTGATGATGGTAATGG - Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136695074 16:32072021-32072043 TAAAATGCTCATCATGATCAAGG + Intergenic
1136795574 16:33015280-33015302 TAAAATGCTCATCATGATCAAGG + Intergenic
1136874348 16:33839096-33839118 TAAAATGCTCATCATGATCAAGG - Intergenic
1137529065 16:49265382-49265404 GAAAATGGAGATAATAATAATGG - Intergenic
1137767367 16:50988257-50988279 CAAAATGGTGATCAAGATACAGG - Intergenic
1138923595 16:61563857-61563879 TAAAATGCTGAATATGACAAAGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139555233 16:67704406-67704428 TAAAATGAAGATAATAATAATGG - Intronic
1140993626 16:80239092-80239114 AAAAATACTGAGAATGAAAAAGG - Intergenic
1141192469 16:81834484-81834506 CAAAATGGAGTTGATGATAATGG + Intronic
1203097829 16_KI270728v1_random:1276944-1276966 TAAAATGCTCATCATGATCAAGG + Intergenic
1142836175 17:2589027-2589049 CAAAAGTCTGTTTATGATAAGGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143862946 17:9904635-9904657 CGAGATGCTGATATTGATAGAGG - Intronic
1144026066 17:11276762-11276784 AAAAATGATGATGATGATGATGG - Intronic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1149280372 17:55098001-55098023 TATAATGATGATGATGATAATGG - Intronic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1150206379 17:63411831-63411853 CAAAATGCTGTTAAAGATCAAGG + Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1152964092 18:98500-98522 CTACATGCTGATAAGGACAAAGG - Intergenic
1153800219 18:8662177-8662199 GAAAATGATGAAAATGAAAATGG + Intergenic
1155244189 18:23891619-23891641 CAAAATGATGTTAAGGATAAGGG + Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1157803438 18:50639514-50639536 GAAAATGCAGAAAATTATAAAGG + Intronic
1159153800 18:64556048-64556070 CAGAATGCTGGTAATTATCATGG + Intergenic
1159451929 18:68613540-68613562 GATGATGGTGATAATGATAAGGG - Intergenic
1159540724 18:69771902-69771924 CAAAATGATGACAAAGATAAAGG + Intronic
1162210253 19:9085656-9085678 CAAAATAATAATAATAATAATGG + Intergenic
1162868577 19:13568226-13568248 CTAAATGATAATAATAATAATGG + Intronic
1162869595 19:13575502-13575524 CTAAATGGGGATAATGCTAATGG + Intronic
1164258954 19:23552649-23552671 CAGAAAGCAGATAATGAGAAAGG - Intronic
1165504370 19:36215504-36215526 GAAAGTGCTGATAATTATAACGG + Intronic
1165712238 19:38020215-38020237 CAAAATGGGGATAATAGTAAGGG - Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168338917 19:55612924-55612946 TAAAATGAGCATAATGATAAGGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925835051 2:7936429-7936451 CAAAATATTGATAATCAAAATGG - Intergenic
926537526 2:14131583-14131605 CAAAATGAAGGTAAGGATAATGG + Intergenic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
927622100 2:24672181-24672203 AAAAATGCTTAAAATGATTATGG + Intronic
928095649 2:28403438-28403460 CAAGATGCTGATGATGGGAAGGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929686778 2:44041969-44041991 CCAAATGTTGATAATGATTGAGG - Intergenic
930221599 2:48751884-48751906 GAAAATGCTAATAATAATTATGG - Intronic
930249243 2:49017084-49017106 TAAAATGCTGATATTTATCAAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931045656 2:58349754-58349776 CAAAATGTTGATAATGTTGGGGG - Intergenic
931161678 2:59699349-59699371 CTATATAATGATAATGATAAAGG - Intergenic
931325284 2:61215705-61215727 AATGATGATGATAATGATAATGG + Intronic
931630796 2:64296756-64296778 CACATTGCTGATAATGAAAGAGG - Intergenic
932574907 2:72957327-72957349 CAAACTGCAAATAATAATAATGG - Intronic
932610111 2:73192515-73192537 AAAAATGGTAATAATAATAATGG - Intergenic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933494875 2:83037579-83037601 CAAAATAATAATAATAATAAAGG + Intergenic
933529065 2:83482822-83482844 AATAATGATGATGATGATAATGG + Intergenic
934130480 2:88943529-88943551 CAAAATGCTATTAATGAGCAGGG - Intergenic
935041142 2:99428459-99428481 CATAATTCTGTTAATGAGAAAGG + Intronic
936761345 2:115787919-115787941 CAAAATGCTGCAAATGCTGACGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
939271664 2:139947299-139947321 AAAAATGATGACAATGATGATGG + Intergenic
939435159 2:142166853-142166875 CAAAATGCCTATTATCATAAAGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940841795 2:158592096-158592118 AGGAATGATGATAATGATAATGG - Intronic
941555385 2:166973162-166973184 CAAAATAGGGAGAATGATAATGG + Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941650911 2:168091755-168091777 CAAAATGTTGATAATGTTGAAGG - Intronic
941692049 2:168510742-168510764 CAAGATGATAGTAATGATAATGG - Intronic
941797996 2:169622555-169622577 CAGATTGCTGAAACTGATAAGGG - Intronic
942241921 2:173970784-173970806 CAGAAAGCTGATAATGTTCAAGG - Intergenic
942762541 2:179416575-179416597 AAAAATAATAATAATGATAACGG + Intergenic
943174381 2:184451171-184451193 AAAAATGCAGATAAGGACAAAGG - Intergenic
943338616 2:186649800-186649822 AAACATGTTAATAATGATAATGG - Intronic
943531590 2:189088473-189088495 CAAAGTGCTGACATTAATAAAGG - Intronic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
945238446 2:207654324-207654346 CAGGATGTTGATAATGGTAAAGG + Intergenic
945445825 2:209937126-209937148 TAAAATGAAGGTAATGATAATGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945869826 2:215214975-215214997 CAAAATAATAATAATAATAAAGG + Intergenic
946510767 2:220353650-220353672 CAAAACTCTGATAAAGAGAAGGG - Intergenic
946554361 2:220838173-220838195 GAAAATGCTGCTATAGATAATGG + Intergenic
946950955 2:224874431-224874453 TAAAATGGTGATAATACTAAGGG - Intronic
947264260 2:228259624-228259646 CAAAATCCCCATAATCATAATGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170390579 20:15868697-15868719 TACTATGCAGATAATGATAAGGG - Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171332500 20:24352920-24352942 AAAAATTTTGGTAATGATAAGGG - Intergenic
1173184142 20:40827661-40827683 AGAAATGATGATGATGATAATGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1175041711 20:56058312-56058334 TAAAATGATGTTAATGGTAATGG - Intergenic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1175526452 20:59637944-59637966 CAAAATGGGGATAATAATAATGG - Intronic
1175668925 20:60884729-60884751 AGTAATGATGATAATGATAATGG + Intergenic
1176258043 20:64163417-64163439 TAACATCCTGATTATGATAATGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177957086 21:27611704-27611726 CATAGTGCTGATAATGGTAATGG - Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179083183 21:38192389-38192411 TAAAATTCAGAGAATGATAAAGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179566006 21:42249632-42249654 CAAAATGATGATGCTGATGATGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181373249 22:22435153-22435175 CAATATGTTGAAAATGATCATGG - Intergenic
1182136702 22:27911552-27911574 CATATTGCTCTTAATGATAAAGG + Intronic
1182946584 22:34329530-34329552 CAGAACACTGATAAAGATAAGGG + Intergenic
1183494337 22:38133869-38133891 CAAGATGATGATGATGATGATGG - Intronic
1184050876 22:42003492-42003514 CAAACTGCTGATAAATAAAAGGG + Intronic
949739654 3:7216279-7216301 CAACATGATGCTAATGATGATGG - Intronic
949755160 3:7400873-7400895 CCAAATGTGGATAATAATAATGG + Intronic
949762438 3:7486268-7486290 AGAAATGATGGTAATGATAATGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951325282 3:21295372-21295394 CAAAATAATAATAATAATAATGG - Intergenic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
952094399 3:29931423-29931445 CAAAATGCTTACAAAGTTAAAGG + Intronic
952201755 3:31136494-31136516 CAACATCCTATTAATGATAAAGG + Intergenic
952557483 3:34549402-34549424 CAAAATGAGGATAACGATTATGG + Intergenic
952815687 3:37445583-37445605 CTAAATGTTAATAATGATTATGG - Intergenic
953087771 3:39688711-39688733 CAAAAGACAGATAATAATAAAGG + Intergenic
955475057 3:59327961-59327983 CAAGATGCTCTCAATGATAATGG - Intergenic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
955882928 3:63566861-63566883 CATAAAGCTGATAAAAATAATGG - Intronic
955959203 3:64321558-64321580 AGAAATGTTGATAATAATAATGG - Intronic
958158822 3:89790265-89790287 CAAAGTGCTGGAAAAGATAAAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959526566 3:107383949-107383971 ATAAATGGTGATAATGATACTGG + Intergenic
959714311 3:109416195-109416217 CAAAATAATAATAATAATAAAGG - Intergenic
959843898 3:111010513-111010535 GAAAATGCAGATAAAGAAAATGG + Intergenic
960109738 3:113834176-113834198 CAAAATAATAATAATAATAATGG - Intronic
960738835 3:120810542-120810564 AAAAATAATGATAATGAAAAGGG + Intergenic
962680466 3:137794387-137794409 AATAATGATGATAATAATAATGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965029365 3:163343953-163343975 CTACATACTAATAATGATAAAGG + Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967099477 3:186204405-186204427 CAAAATAATAATAATAATAATGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970058516 4:12002438-12002460 CAAAATGGTGATTCTAATAATGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970416546 4:15863412-15863434 GATAATGATGATAATGATGATGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971147356 4:23993578-23993600 CAAAATGGGGCTGATGATAATGG - Intergenic
971181207 4:24330018-24330040 CATGATGATGATAATGATAAGGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971556352 4:28016956-28016978 AAAAATGATGATGATGAAAAAGG + Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972268372 4:37484565-37484587 CAGGAAGCTGATAATCATAAGGG - Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974625859 4:64428543-64428565 CAAAATGCTAATCATAATACAGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
974731497 4:65872323-65872345 CAAAATAATAATAATAATAATGG + Intergenic
975320424 4:73004246-73004268 TAAAATGCTGGTAAAAATAAAGG - Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975587028 4:75960065-75960087 GAGAATGCTGAAAATGATGAAGG - Exonic
975766953 4:77678578-77678600 CAAAATAATGAGAAAGATAAAGG + Intergenic
975817268 4:78231337-78231359 GAAAATACAGATAAGGATAAAGG + Intronic
975842978 4:78495755-78495777 CAAAATAATAATAATAATAAAGG - Intronic
976786172 4:88823961-88823983 CAAAATGCTGTTGATGTTCATGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977486469 4:97653670-97653692 CAAAATTATGTTATTGATAATGG + Intronic
977864345 4:102005638-102005660 CATAATGCAAATAATAATAATGG - Intronic
978180892 4:105794467-105794489 CATGATGCTGACAATGAGAAAGG + Intronic
978478006 4:109154132-109154154 CATAAAGATGATAATCATAAAGG - Intronic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979815075 4:125090863-125090885 CAAAAAGATGACAAGGATAAGGG - Intergenic
979882574 4:125980233-125980255 GGAGATGCTGATAATGAGAAAGG + Intergenic
979933639 4:126664594-126664616 CAAAACACATATAATGATAAAGG - Intergenic
980234598 4:130089605-130089627 CCAGATACTGATAATGGTAATGG - Intergenic
981109065 4:140914710-140914732 CAAAATGCTTCTGATAATAAAGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981729890 4:147886186-147886208 CAAAATGCTTGCAATGAGAAGGG - Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982622105 4:157721493-157721515 GAAAATAATAATAATGATAATGG - Intergenic
982762231 4:159299075-159299097 CAAAACCCTGACAATGATATGGG + Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983849175 4:172559035-172559057 AAGGATGATGATAATGATAATGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988020200 5:25611292-25611314 AAAAATAATAATAATGATAATGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989107782 5:37879750-37879772 GAGAATGATGATAATGGTAATGG + Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989845992 5:46141994-46142016 CAAACTGCTGAAAAAAATAAAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991989464 5:72323231-72323253 CAAAATATTGATAATGATTGAGG + Intronic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992504060 5:77368089-77368111 CTAAATGCTGCTACTGAAAATGG - Intronic
992570851 5:78055652-78055674 CAAAATGGTCCTTATGATAAAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993111116 5:83658620-83658642 CAAAATAATGATAAAGTTAAAGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995466765 5:112457867-112457889 CAAAATAAGGATATTGATAAAGG + Intergenic
995908103 5:117150801-117150823 CAAGATACGGAAAATGATAAGGG - Intergenic
995969499 5:117950839-117950861 GAAAATTTTGATAATGAGAAGGG + Intergenic
996122086 5:119684024-119684046 TAAAATGGTGATAATACTAATGG + Intergenic
996230058 5:121052321-121052343 CCAAATGATTATAAGGATAAGGG - Intergenic
996347989 5:122508290-122508312 TAAAATGGAGATAATGATAATGG - Intergenic
996639195 5:125731331-125731353 AAAAATGCTGAAAATGCAAAAGG + Intergenic
997959928 5:138312810-138312832 GAAAATGGTTATGATGATAAAGG + Intronic
998424979 5:142018829-142018851 TAAAATGGGGATAATCATAATGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004451405 6:15751148-15751170 CAAAATGTTGAAAATGACAAAGG - Intergenic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006928826 6:37675079-37675101 CAAAAAACTGTTAATGATGAGGG + Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009051968 6:58286770-58286792 AAAAATGATGATGATGATGATGG - Intergenic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010391243 6:75340427-75340449 CAAAAAGATGACTATGATAATGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010753981 6:79645518-79645540 GAAAATGGTGAGAATGATGAGGG - Intronic
1011412302 6:87078455-87078477 CCAAATGAAGATAATGTTAATGG + Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011830991 6:91371223-91371245 CAAAATGGTAATTATTATAATGG + Intergenic
1011992766 6:93544366-93544388 AAAATAGCTGATAATGACAAAGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012652068 6:101767357-101767379 CAAAATGTTTATAATGGTAATGG - Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013181404 6:107719728-107719750 TAAAATTGTGATAATAATAATGG - Intronic
1013364005 6:109421545-109421567 GAAGATGATGATAATGAGAAGGG - Intronic
1013746788 6:113355375-113355397 AATAATAATGATAATGATAATGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014698904 6:124658596-124658618 TAAAATGCTGATGATAACAAAGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015508758 6:134016723-134016745 CAAACTGTTGATAACCATAAGGG - Intronic
1015652303 6:135477388-135477410 TAAAAAGCCAATAATGATAATGG - Intronic
1015828290 6:137339491-137339513 TAAAATCCTGATGATGTTAAAGG - Intergenic
1015915487 6:138212025-138212047 CAAAATGCTTAAAAAGATAAGGG + Intronic
1016273515 6:142319792-142319814 CATAATTATGATAAAGATAAAGG - Intronic
1017424785 6:154309257-154309279 CAAATTTGTGATATTGATAAAGG - Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1018456475 6:163958231-163958253 CAAAATGGTCAGAATGATTAGGG + Intergenic
1018840931 6:167516045-167516067 AATGATGGTGATAATGATAATGG - Intergenic
1018840966 6:167516444-167516466 CAAGATGCTGATGACGATGATGG - Intergenic
1018913742 6:168120075-168120097 AAAAATAATGATGATGATAATGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019353459 7:566344-566366 GAATATGGTGATGATGATAATGG - Intronic
1019824285 7:3270748-3270770 GATAATGATGATGATGATAATGG + Intergenic
1020471323 7:8538498-8538520 TAAAATGAGGATAAAGATAATGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022185908 7:27968658-27968680 CAGAATGCTTTTAATAATAAAGG - Intronic
1022967904 7:35490830-35490852 CAACATGATGATAACTATAAAGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1025605293 7:63035818-63035840 CAAAATGGTGTTCATGACAACGG - Intergenic
1026467405 7:70666207-70666229 CAAAATGGGAATAATGATAATGG + Intronic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1027493756 7:78861653-78861675 CAAAATAAAAATAATGATAATGG + Intronic
1028550676 7:92060172-92060194 CAAAATCATGATAATACTAAAGG - Intronic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032609679 7:133398953-133398975 CTAAATGAGGATAATAATAATGG - Intronic
1032707027 7:134429981-134430003 TAAAATGGAGATAATGCTAATGG - Intergenic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033037467 7:137888265-137888287 CAAAATGCTTTTAAAGAAAATGG - Intronic
1033401597 7:141030848-141030870 CAATTTGCAGATTATGATAAAGG + Intergenic
1033995582 7:147342238-147342260 CAGAATGTAAATAATGATAATGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036779635 8:11636931-11636953 CAAAATGGTGTTCATGACAAGGG + Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1036971340 8:13358696-13358718 AAAAATGCTAACAAAGATAAAGG + Intronic
1038202201 8:25423626-25423648 CAAAATGATGAACTTGATAAGGG - Exonic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041255001 8:55972365-55972387 CAAGAAGCAGATAATGATTAAGG - Intronic
1041876888 8:62698801-62698823 GAAAATGCTGAAAAAGATAATGG + Intronic
1042018445 8:64343293-64343315 AAAAGTGCTGATGATGATCAGGG - Intergenic
1042120457 8:65481779-65481801 CACGATGATGATGATGATAATGG - Intergenic
1042391771 8:68244239-68244261 TAAAATGCTTTTCATGATAAAGG + Intergenic
1042508064 8:69582518-69582540 CACTATGGTGATAATAATAATGG - Intronic
1043576056 8:81657913-81657935 AAAAATAATAATAATGATAATGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043975111 8:86576006-86576028 GAAAATGAAGATAAAGATAAAGG - Exonic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044928952 8:97233672-97233694 CCAAATACTAATAATGATAATGG - Intergenic
1044959637 8:97517824-97517846 CAAAACTTTGAAAATGATAAAGG + Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045526853 8:102947992-102948014 CAAGATGCAGAAAATGATGAAGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046841622 8:118864966-118864988 GAAACTGGTGATAATGATGATGG - Intergenic
1047886748 8:129259444-129259466 CAAAATACAGCTAAAGATAATGG - Intergenic
1047894564 8:129352301-129352323 TAATATGATGATACTGATAATGG + Intergenic
1048556770 8:135485693-135485715 AATAATGATGATAAAGATAAGGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052205237 9:25831057-25831079 CAACATGAAGATAAGGATAAAGG - Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052520194 9:29537388-29537410 GATAATGGTGATGATGATAATGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1052968435 9:34361090-34361112 CAAACTCATGATAATGACAATGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056679883 9:88707758-88707780 GAAAATTCTGAGAAAGATAAAGG + Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058212928 9:102195214-102195236 GAAAACACTGAAAATGATAAAGG + Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058756621 9:108088663-108088685 CAAGATGCTGATGCTGAAAATGG - Intergenic
1059521877 9:114950419-114950441 CAAAAAAATGATAATAATAAAGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059847810 9:118300970-118300992 CCAAATTCTGATACTGATACTGG - Intergenic
1060033570 9:120235864-120235886 CAACATGATGATAATGATGGTGG - Intergenic
1060451667 9:123748265-123748287 CACCATGCTGATAATGACTAAGG - Intronic
1060935904 9:127515835-127515857 CAAAATAATAATAATAATAATGG + Intronic
1062734021 9:138125285-138125307 CTACATGCTGATAAGGACAAAGG + Intergenic
1203691743 Un_GL000214v1:48587-48609 CACATTGCTGAGAATGGTAAGGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1203644552 Un_KI270751v1:55604-55626 CACATTGCTGAGAATGGTAAGGG + Intergenic
1185683060 X:1904644-1904666 GATAATGGTGATAATGATGATGG + Intergenic
1185689060 X:2138136-2138158 CGAGATGATGATGATGATAATGG - Intergenic
1185996893 X:4961834-4961856 CAAAATGCGGAAAAATATAATGG + Intergenic
1186131656 X:6473224-6473246 GTAAATGATGATAATGATTATGG + Intergenic
1187191470 X:17039223-17039245 CAAAATCCTGATAATAGTGAAGG + Intronic
1187207837 X:17199670-17199692 CAAAATGAGGACAATGATGATGG + Intergenic
1188051131 X:25487960-25487982 CAAGATGATGATGATGATAACGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188348019 X:29092086-29092108 CAAATTGATGAAAATGAGAAGGG - Intronic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191969375 X:66796581-66796603 TAAAATGGGGATAATAATAATGG + Intergenic
1192207195 X:69104352-69104374 TAAAATGGTGATGATGATAATGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193257755 X:79369172-79369194 CAAAATTATGATAACGATCAAGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194480875 X:94422465-94422487 CTATATAATGATAATGATAAAGG - Intergenic
1194650383 X:96507548-96507570 TAAAATCCTGGTGATGATAATGG - Intergenic
1195241995 X:102961096-102961118 GATGATGCTGATGATGATAATGG - Intergenic
1195509524 X:105698173-105698195 AATAATGATGATAATGATAGTGG - Intronic
1195588243 X:106591724-106591746 TAAGATGCTGAAAATTATAAAGG - Intergenic
1195710504 X:107769546-107769568 CAAAATTTTGGGAATGATAATGG + Intronic
1196092491 X:111761020-111761042 CAAAAGGCAGATAAAGAGAAAGG + Intergenic
1197258007 X:124284961-124284983 CACAAGGCTGATAACCATAAAGG - Intronic
1197295499 X:124714014-124714036 ATAATTGCTGTTAATGATAATGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197673555 X:129305196-129305218 GAAAGTGATGACAATGATAAAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198626809 X:138584722-138584744 CAAAATGCTAATAATGCAAGCGG - Intergenic
1198733507 X:139760300-139760322 GAAAATGATGATAATGATGATGG - Intronic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199870958 X:151898398-151898420 AAAAATATTGATAATGATGATGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic