ID: 1188054078

View in Genome Browser
Species Human (GRCh38)
Location X:25521672-25521694
Sequence CAGTTTCATCAGAATTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188054078_1188054087 25 Left 1188054078 X:25521672-25521694 CCCCACAAATTCTGATGAAACTG No data
Right 1188054087 X:25521720-25521742 GATGCAAAACAAAGCTCCTCAGG No data
1188054078_1188054083 -5 Left 1188054078 X:25521672-25521694 CCCCACAAATTCTGATGAAACTG No data
Right 1188054083 X:25521690-25521712 AACTGATCTGGGTTTCAGCCTGG No data
1188054078_1188054085 3 Left 1188054078 X:25521672-25521694 CCCCACAAATTCTGATGAAACTG No data
Right 1188054085 X:25521698-25521720 TGGGTTTCAGCCTGGATATTGGG No data
1188054078_1188054084 2 Left 1188054078 X:25521672-25521694 CCCCACAAATTCTGATGAAACTG No data
Right 1188054084 X:25521697-25521719 CTGGGTTTCAGCCTGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188054078 Original CRISPR CAGTTTCATCAGAATTTGTG GGG (reversed) Intergenic
No off target data available for this crispr