ID: 1188054689

View in Genome Browser
Species Human (GRCh38)
Location X:25527528-25527550
Sequence CTTTATTAGCAGAATGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188054689_1188054691 -6 Left 1188054689 X:25527528-25527550 CCGTTCTCATTCTGCTAATAAAG No data
Right 1188054691 X:25527545-25527567 ATAAAGACATACCTGAGACTGGG 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
1188054689_1188054690 -7 Left 1188054689 X:25527528-25527550 CCGTTCTCATTCTGCTAATAAAG No data
Right 1188054690 X:25527544-25527566 AATAAAGACATACCTGAGACTGG 0: 1097
1: 3639
2: 7030
3: 10378
4: 10910
1188054689_1188054694 14 Left 1188054689 X:25527528-25527550 CCGTTCTCATTCTGCTAATAAAG No data
Right 1188054694 X:25527565-25527587 GGGTAATTTATAAAGGACAGAGG 0: 20
1: 3591
2: 8230
3: 9056
4: 8292
1188054689_1188054693 7 Left 1188054689 X:25527528-25527550 CCGTTCTCATTCTGCTAATAAAG No data
Right 1188054693 X:25527558-25527580 TGAGACTGGGTAATTTATAAAGG 0: 1925
1: 3198
2: 4070
3: 3254
4: 1860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188054689 Original CRISPR CTTTATTAGCAGAATGAGAA CGG (reversed) Intergenic
No off target data available for this crispr