ID: 1188058304

View in Genome Browser
Species Human (GRCh38)
Location X:25567532-25567554
Sequence AATATCTAGGATATTTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188058304_1188058307 4 Left 1188058304 X:25567532-25567554 CCTCCTAAAATATCCTAGATATT No data
Right 1188058307 X:25567559-25567581 TTTTTTGCAGTTGTTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188058304 Original CRISPR AATATCTAGGATATTTTAGG AGG (reversed) Intergenic
No off target data available for this crispr