ID: 1188059396

View in Genome Browser
Species Human (GRCh38)
Location X:25582411-25582433
Sequence TTTGAGAGGCCCAGTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188059393_1188059396 14 Left 1188059393 X:25582374-25582396 CCAGAGTCAAGGCATGCGTGAAC No data
Right 1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG No data
1188059392_1188059396 15 Left 1188059392 X:25582373-25582395 CCCAGAGTCAAGGCATGCGTGAA No data
Right 1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188059396 Original CRISPR TTTGAGAGGCCCAGTGATGA AGG Intergenic
No off target data available for this crispr